GenePrediction:GLEAN_510 Details

Name: GLEAN_510
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:262190..264897 (+ strand)
Length: 2708
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:262190..262384 (+ strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_97:262429..262548 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:262617..262775 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_97:262954..264897 (+ strand)
Length: 1944
>GLEAN_510 class=GenePrediction position=GCSC_97:262190..264897 (+ strand)
ATGCCAGGAGGACACGCAAAAGAGCGTCACAAAAAGAGCACAAGAGCTGGCGGCTGGAATGTTCCGGCACCAGCTACCTT
GAATGCAAGGCCAGAGGCCCCTGGCCTCAAGTCAAAACACCACTCTTACTTTGAGCTTGTCGAAAACAAGGACAAAAAGA
AGAAGCTCGAGTTCAAGGCATGGTTCCCTCAACCCGTCTGCCCCTTGAAATAGTACTGATGACCCTGAACGCCCGATAGA
TCACCAGCGACAGACAGCCACCTCCAGGCTTCGAATTTGTTCCTATCGGCAACCCGGAATTAACGACTGCCTGCAAGGAG
CTGTCGCGTGAACAAGACGCGTTGATATTCATCGTATCCGTACGTATGATCATAGATTCACGGGGCCTCCTATTGTCTCT
CCGCTGACCAGCTTCTGTCGCATGCAGACGGACAAGCGGGCTGTGGCTGCGTCACTATCATACCAAGTCAACCGAATTGG
ACATCACATACGGCAGATGATCGTTGAGCAGGCACGGGCATCGATTGGCGACAGCGATCATTCCTCAGTGGGACAGAACC
TGTCCGGCCTTCCAGAGCCCATTCCGGTGACTCAAGAGGAAATTAACGAGCAGGCTGATAAAGCAATCAGAGACTTATTT
CCCAGGATTCCCAATACAGACCGCCAGACCATCATCGAACACTCGTTCAAAAAGGTTCCATCCTCTTCTGTACTCCGCAC
CCCAGCCCAGTCCAAGCAAAAGGCTAACATGGAAACCGCTTCAGGGTGCGACGAAAAAAGGCGAGCCGTTGGTCGGCTTG
GCCAAAGACATCACACTGTCCCGCCGTGTACAGCTAGCTGTGCTAGCGCATATCCGCCATACCCATACCCGATACGACCG
CCTTCTAAAAGAGACGTCCTACGCAAACGCCCGAAGGACTGTTGAGGCACTATGCCTAGATATACTCGTCAAGTGGCGAG
GCGATGAAGAAACAGGGCGCGACCAGCTCGACGAGATCCTCCGCGAGGTGATTGTCATCTCCGATTCCGAGGGTGAAGAT
GATGGCTATACTAGCGACACTGCAAACAGCGAGTCAGATGACTCGGTCGAGGACATTACTCGGCACGCTGCACCTGACCG
GGTCAGCCCTGTGGTTGGCTTTGCACACTATGTTGTCAGGCCTCCGGCAGTAGATGCGCGCTCCACTACAGAGGCACCTG
CATATGACTTTGCGCAGGACGCCAGGAGTGCTACCGTGTCCACATACGTGAGCGCGCCGTCGCAGACCTTTGAGAGTCTC
GGCGTGAAAAGAGGTCGCCGGGGATTCAGGAGATACGAAGCGGCCTTGACGGCACGCTGGGACGAGGCTAAGAACCGGGT
TCGCCTGCAGGAAGAGCTTCCAGGTGGCCCAAATGGGCCCACAGCAGATCGTCTGGATTCGCATTATGAGCCGCCACAAC
AGGACCCCTCTTATGCACTGGAGCCTCCATCTTACTGGGAACTGTCAGAGCGCAGGGAAGCTGTGCAGGATCACGGCCGG
CCTGCCGGCTATGGGGCGCAACGTCGTGTTGTCCATCCGTCCGCCATCCACGGTGGGTATCCGGCATATGAGTATGACCA
ACCGCCTATGCAGCTGTCAGGACCGTATCCAGATATCAGTGCTCCTCCGCTACCGCACAGGGTCTTCTCACATCCCCTGC
CAAGAAATAATAGTCCCCGTAATGGGCCAGGCTATGACCTAAACCCAAGGGCAATGGTAAGATCCCAAGAAGTTCAAGAT
TATCTGGTGCCGTCCATTGAGCCTTCGTCGCCGACTGGCGAATCGGACGCCTTCGTTCCTATTCTAGTGCGCACGTTGCC
GCCTCGTCCTAGCGCTCAGGAGAGCTATCATGGCGAGGCTCTGGCGCGTTATGACATGCACCACTCACCTAGTTGGGGAG
AGGAGTCATATGATAATGTCAAGCACAGGCGTGTTACGAGTGACTCCACTTTCATACGGCTACCGCCTCATCAAGAACCG
CATCCTGTCTATGTAGCCCGCGAGGATCACCACGGGCAAGGTATTGTTCCCTACGTCCGGGCGCCACCTTTTGGATCATC
CGTTCGTGCACAAGCACAGGAGGACTATCGCCAGGCTTCAGCTTGGCCCATAGCACAACCGACTTCTCTAGGGCCTGCTC
CCGCACCTGTGATGCGGGCGTACCACCCAATTGGTGGCCCCATGCGACCAGTGGTTGTCGATGACTGGCCTGTGCATGCG
CCCCAGCTTGCACCCCAAGTTGGGATGACTTCAATCTCTCAGGCTTTTCAGGAGAACAACCCCCGAGAGCGACGGATGCC
TGAGGCTCGTCGAGAAATGTACCATTTTGCTGGTAACCTTTCTGACTCGTCTATGGACGAGTACATAGAAAGCCAGCCTC
GAGCTCCTTTGCCATGGGATGACCTGGGCTGTCGCCAGTCCTTGAAAAGGACTGCTGATGGAGCCAGGTTTAATGGGGAA
AATCCCTTTCGGTATGACCCGCAGGCATCACGGCCTCTGGAACAGCAATCTGCCGCCGTGTTTACAGCTCGGTATGGTCA
ACAACACGATCGTGCTGGGCAATACCCCTCTGGCCTGCCGATGTCTGCTGCCGATGTGCAGCCAGATGCTCGATACTTCC
ACCGGGTGGACAATGCTTGGCCTGAGTATGCTGCTTTCTATCTTGTCGACGTGGGATTCGGTTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62