GenePrediction:GLEAN_5110 Details

Name: GLEAN_5110
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1772757..1769732 (- strand)
Length: 3026
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1772757..1772516 (- strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_97:1772450..1769732 (- strand)
Length: 2719
>GLEAN_5110 class=GenePrediction position=GCSC_97:1772757..1769732 (- strand)
ATGCCTAGATTCCCCTCTGCGTTCAGCCGGCGGAAATCGTCCGTCGATAACGTTGACCGTGCGGCTACAGCCGGGCCTTC
GTTCCGTGTGTTAGACCGATCCGAAGTGACTGGTTCTCCAAAGAGTCCCAACTCCGACCATCTGACTGTTCGCCGGCCAG
TCAAGTCCCGTACCATTCCCAGCAGCCTGGCGGAGGCCACCTTGGAAGAGGACAACATCTTTTCCGACCTCAAGACTAAC
CGGTACGTTGTTTCATCTACTTGTGTTTGTGGAAAGCGAGAATTCAAGAAGCACTAACGTAACGTAGCGGCAGCGGTTCA
TCCAATACCATTAAGACCATATCCACTGACAATTCCTCGCGGCACAGCAACGCGTCCACTGCCCCCTCCTCTGCCGACTT
CAGCGCACAAAACCAGCACCAGGTGTATCAGGCGTACCAGCCATACCAGCACCAGGAAGACTGGAGACACAGTAGCGGCC
AGGCCCCGCCTCCCATCCCAAAGTCGAGCTCCAGCAGCTTCCTCAGATCCGCTGGGCGCACCTTTTCTTTTGGAGGACAG
AAAAAGGCACAATCCATCGCTCCTTCGTACGACGAGCGCTCTCAAGTGTCAACACCACCAGACAGATCAGGCCGGGAACG
TGCCGCCACCGCGTCTACTACCAGCACTGCCACGCCTCCCAGAGTGGACGAGGACTTCAATCTCGACCTCGGCGGCGACT
TCAGCAAAATGCTCGGCCTTGATAAGCGGGCGAGTCAGATGACCGTCCGCGAAGACGGACCGGAACGTCCTGCCCTGGCG
CCTCGCTCGCTGACAGGCAATCGGCTCAACCAGCCACAGCCTATGCAGCTGGACGTTGCCTCGAAAATCGAACCGTCGCC
GCTTTCGTGGGGTAGCCATCACTCAAACGACCAGCTCCTGCAGCCTATCTCAGCTCGTGCGTCTCCCACCAACGAAAATG
TGCCGCCTGTTCCGAGACACGCTCTGCAATACGGCAACAGGTCGGACAAGACAGAAACGGCTGCCCCCATCCCTGTCTCT
AGCTCTGCACCAGCCCCTCCTTCCGCCGACTCGAACTTGAAGAGAAGCAGTGCCGTTTTTGGCCGACGGCGCTCCAATGC
CGAATTCCCCCCCGAAGCCGAAGTCGAAGCCGAAGACGATGACGCTGATCTGCTGAAGGACTCATTCTCCACCGTCAGCA
AGTTTCTCAACGGTGCACACGCGACTTCTGCTATCGCCAAGTCATCTGCGACAGTCTCCAATCGATTCAGTGGATACAGA
CAGGTGCCGACCGGGTCGGAGGCACCGCACGAGTTGAACACTCACATTGAAGAAGACAACATGTTCGACACACCGCTGAC
CCCTGTTAGCCAAGCGGCCTCGCGTCCGCCGGTCCGCCCGCTCAGTCCGACGCAAAATAAGGTCATGACGCCGGCAGAGT
TTGAGCGGTACCGGAAGGATAAGGAGCGTGAAACGCGCAGGTCTGCCGTCTTGACGAAAGCGGATGGAACCCTGGCGATC
GAGGACGCGGACAATTATGACGAAGACGAGTTTGAGGATGAGGCCGAGAAACTGAAAGAAGCTGCGAAACAGAGACGCAA
GCAGGAGGCACACATGGCTGTCTATCGTCAGCAGATGATGAAGGTCACCGGTGAAACTTCATCTGGCTCCGCTGCACGCC
CCCCGATGCAGTCATTCTCGAGTCCGAGCCTGCTGGGTGTCGGCAGTTCCAACAGTCTTGCTGGGCCCGGACCTTTACAG
CAGGCCGGCTCTGATGTTTCAGACGACGAGGAAGTACCGCTCGCTATTCTTGCAGCCCACGGGTTTCCTAATAAGAACCG
CCCGCCAGTGCGCTTGACCACGATGATGTCGAACCCGAACCTTCGCGCCGCAGCCACGCCAAGCTTCCAGCGGCCCGGCA
CAGCTGCGGGCGATGCTCAAAGCGGCGGTGCTGTAAACGGTCGGCTGCCGCCTTTCGCCAGAAACCTGCCCCAGGACCCG
TATGGTCTGGTCAGTCCTCCTGTCCGAGAAACGCTCCAGTTCAGCGGCGGTGCACCGGCGGTGTTGCCGCGGCCGAGCAG
CCCGCTGCCACATGGGGGCCTTGTCGGAGTGATTGCCAACGAAGAACGGTCGCGCGCCTTGCGACGAGGCAACCAGCACG
TCGAGGGGGCAAACAAGCCCATGCCGAACATGATGACGGGAGTCCAGTTTGACCCGGCTGGAGTTCCGCAGCACATGATG
TACCCGGCCACGGCACAGCCCCAGGTGCTCTCCCCGGGCGACCAGGCCCAGATTCAAATGACACAGCAGATGCAGCAGTT
TATGCAGATGCAGATGCAGTTCATGCAGATGATGGCCAACGGCGGGAATGCGATGCCGCAGCAGCGTCCCGAGAGCCACT
ACTCAAACGCCAGCGGGATGAACCCGATGATGGGCGGTGCAGGCATGGGCATGGGAGGCCCCGACATGATGCGACAGCCG
TCCTTCATGGACAACGGCCCGATGGCCGACATGACGGGGCAGCAGCATGCCGACCCGCAGCATATGCGGACGATGAGCAT
GGTGCAGCCGAGTTCTGCCTCGTGGATCCAGCCTCTGGCACTCAACTCAGGCCTGGCCCCGTCGATTCGACTTCAGGGAG
CCAACGGATATGCACCTTCGATTGCTCCCTCTGAGCGGAGCAACGTTGGTCTTCCAGGACGGTATCGGCCGGTGTCTCAC
ATGGCCTCTGCTTCCCAGCCGATTGACATGCCGAAGCCCTTGACCGTGCCGGGGACGCTTGGTGTTGGCGCAGCCGATGG
CATCGCTAGCGAGAGCTCCACGCCGGGCACTGCAAGCCCTGCCGGTTGGGACCAGTCGAGAAAGCACATCAACCGGTCGC
CTCTCAACAACTCGTCGACTGCTGACGGTGACGACGATGACGATGAGGAAGGCTGGGCGGCCATGAAGGCCGAACGGGAG
AAGAAGATCTCCCTTTGGAAGACGAAGAAGACGCTGGGCAGCGATATCGGTGCTCTCATCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62