GenePrediction:GLEAN_5113 Details

Name: GLEAN_5113
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1759001..1753731 (- strand)
Length: 5271
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1759001..1758047 (- strand)
Length: 955
Type: CDS
Source: GLEAN
Position: GCSC_97:1757987..1756874 (- strand)
Length: 1114
Type: CDS
Source: GLEAN
Position: GCSC_97:1756824..1756742 (- strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_97:1756109..1756072 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_97:1756007..1755920 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_97:1755862..1755513 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_97:1755440..1753731 (- strand)
Length: 1710
>GLEAN_5113 class=GenePrediction position=GCSC_97:1759001..1753731 (- strand)
ATGGCTCCCAGCCGGCCGATTGCGGTGGCTTCGCCGGCCAATGGTGACCGACGCGGGTCCTTTGCCGGGCTGGTGTCGTC
GCTCGGCGCGTCGTTTGTGAATCCGTCGCCGCTAGCCCACGAAGCCGTTTTACGCGACGTGGCCAGCCTGTACGAGTCAG
AGCTGGAGGCAGACGAGCGGACGGCAGAGACGGACGACGACGACCTCGCGACCGACTCGGACCTGAACTCGGACTCGGAC
AGCCAGCCAGACGTCGGGGCGCCCGACCTCTACCGTCGTCCCAGCGGCATTGCCTATGGCACCTCGCGACCGGCCATCGG
TCTGCTGGCGCCCATTACCGGGCCACCGCTCAGCAGGCTTGAGCGCAAGGCGTCGCGTCACGCCGAGCGCAGCCTGTTGC
GGGACAACCACCTGCTGCCGCCAAAGCACGCGTCCGTGGCAAATGGTGGAGGAAGTGCAGGGAGTGTGGCTGGTGTGGCG
AGCAGCAGTGCCGACGTCGGCGTGGTTGAGCAGGCCGGCCTGCTAACACGGCTCTACAAGCGCATGTTCAGCACCAAGGT
GCCGCGCAAGACGGCCGACGAGGAGCGGCTGCCACGGATGCCGTCAATGGCGGCCGACGGGGCGACGACGCCCTTCCTGA
CGCCGTCATGGGGACAACACGCGAGCGACAGCGCCGACACGACCACCACAACGCCCACCGAACACACCGCCCTTTTGGCT
GCTCCGCCACCGGCACCCCCGGCAGGCGAGCCGACCAGCCACCGACACCTCGACGAGCAGTGGGAGGCCGCCGTGGCAGC
CGGCCAGATCCACACGACGTGGCAGCGCGAGGCACAGACGATCGCGGTTTACTCGCGCTCGCTCATCATCACCTTTCTGC
TGCAGTATTCGATCAACATCACGAGCATCTTTGCGGTGGGCCACATAGGCAAGGTGGAGCTGGGAGCAGTGAGCTGTGGG
TTTTTTTTCTTTCCCTTTTTCCCTCCCCTTTACACACTTTGCTAAGCTCAGCAGTGGCCTCCATGACGGCCAGCATCACG
TTCTACTCACCCGTGCAGGGCCTGGCCACGTGCCTAGACACGCTTTGCGCACAGGCATACGGATCGGGCCACAAGACGCT
GGTGGGTCTGCAGCTGCAGCGCATGTGCTGCTTCTTGGTGCTGCTGATCGTGCCGTTGGAGTACCTCTGGCTACACGCGG
ACGGCGTGCTGGCAGCACTGATCCCAGACCAGGAAACAGCGGTGCTGGCAGGCCGGTACCTGCGGGTGCTAGCGTACAGC
ATGCCGGCGAGCGCGGTGTTTGAGTGCGCGAAGCGCTACATGATGGCACAGGGGCTCTTTATGGCCAACACGTATGTGCT
GCTGATTGCGGCACCGTTCAACGTGTTGCTGAACTGGTACCTGGTGTGGCATCTGGAGCTGGGCTTCATCGGGGCGCCGA
TCAGCAGTGCCATCACGCAGTGGCTGATGCCGACGCTGTTGCTGCTGTACGTGCTCTTCATTGACGGGTCGCAGTGTTGG
GGCGGCTTCTCGCGGCGTGTCTTCAGCAACTGGGGCCCGATGGTGCGACTGGCATTGCCGGGCATGGTCATGATCGAGGC
CGAGTACTTTGCCTTTGAGGTGCTGACGCTGGCGTCCGGGCAGTTCGGCACGACCGAGCTGGCCGCTCAGAGCATCCTGG
TGACTATCACGTCAACCACGTACCAGATTCCCTTTCCTATGTCTATTGCGGCGTCGACACGCATTGCGAACCTGATCGGC
GCCCGTCTGCCTGAGGCTGCCAAGACGTGCGCGCGCGTGGCCGTCGTGGCCGGCGTGCTGATCGGCTTCTTCAACGTCGC
GCTCGTTGCTGGCTTCCGCTACCAGATCCCCGGCCTCTTTACCAGCGACCCCGACGTGGCCGCGACGGTGGCTCTGGCCA
TTCCCATCTGCGCTTTCATGCAGGTCTTTGACGGGCTCTCGGCCGTGGCCAACGGGCTGCTTCGCGGCGTCGGCCGCCAG
GAGATTGGCGGCTATGCCAGCCTGGCAGCCTACTATCTGATCGGACTGCCGCTGTCCTTTTACCTGGCCTTTTACCGCGA
CTGGAAGCTGCCGGGGCTGTGGGCGGGCGTGACGCTGGGGCTTGCGCTGTGAGTGTTTCCTTTTGTTCTGTTTCTGTCCC
TTCCGCTAACTGGCCAGTGTCTCCATCGCCGAATACCGCTATCTCTACAAATACAACTGGCAGAACGCCGTGGAGGAGGC
CGAAGAGCGGAATGCGTCTGGTTAGACCGTCTCCTCTGGCACGTTTAAATGCATTCCTTACATCATCATCACATGCTTGT
ATGCCGTGTAATGCTAGTGAAGGCTGGCTGCGCCCCCACTACAGCTGGCCCCGCTGTAACCTTAAAACCCAGCAGCCTGC
AGGCCTGCAACCAACTGTCCTCTCCCAGCGGTCTTGAAACAGCCCCGCCGCAAAAGCACTCTGGATGCAGGTGGCCAGTC
CGAGCCGCGCCTTCTGCCCTCTACCCACCTGCCTCCTGTCTCCCCAACGCTCCTGCCTCTCGTATTCTCGTCGACGTTCT
CCGTACTCTGTAAAAGCCCAAGATTTGGCTACATAGGACAATCGCGCCCAGTTTTCTCTTTTCTCCTGCAATCCAGACGT
CCTCGCTCTTCCCAGTCGCTTCCGCCTCCGCCATCCGACCGCTGCCACCGCCTTTTGCAACAGCAGCAACAGCAGCGGCA
GCAGCAGCAGCAACAGCAGCAGCAGCAGCAAGCGTCTCGTCTCCAACGGTGCCCAACATGGGTCTCTCCGTCATCCAAGA
ACAGCAGCAAAGTGCGGCCGTCTCTGTCTCTCTCTCTCTCTCTCTTCCTTCGGCTGCGGCCTGATCCTGCAGGTGCTGAC
GGTCCGAAACAGTCCTGATAGAAACGATCAAGAACATCACACGAGGCGACGTGAGCATTTCTCAACACCTATTCTCGTCT
GGTGGCGTCCGCTGACCGACGTCTGTCTACATAGTGGAAGGTTCTCGTGCTCGACGAAAACACCAAGAAGATCATCGACA
ATGTGGTCAAGGAAGATGACATACTCAACCAGAACATTGCCAGTATGTGGAGAGCAGGACGGAAGACAGAGGACGGAGCA
CGCTAACAAAAGACGTCAGACATCGAGCAGATCGAGGAACGGCGCGAGAAGAACCCGACGATGGACGCGATCTACCTGAT
CTCGCCACAACCGCATATTGTCGAGTGTCTGCTGGCCGACCTGGACCGAAAGCGATACCGGCGGGCGTTTGTGGTGTGGT
CGTCGGCGCTGGACGGACAGCTGCGCCAGCGCATCGACTCGGTGCCGGCAGCACGGCAGCTGATCGCCGGCATCGAGACG
CTGGCCATTAATTTTTTCCCGCGCGAGTCGAACCTGGTGACGTTCCGCGACCCGTGGAGCTTCCCGGTCCTCTTCCACCC
GGACTGCAACGGCATGGTGCGACAGCACATGGAGGACCTGGCACACAAGGTGAGCGAGCTGTAGGCGGATTGCAAAACGC
GGATCCCGGCTGTGCTGTCATGGTGCTGACTGAGGCTGCAGATTTCGAGCGTCTGCATATCGTCGGGAGAATACCCAAAG
GTGCGCTACTACCGGCCGCGGGCACCGCTGCATGAGGCCAGCGTGCTGTGCACACATCTGGCACGGTTCGTGCAGGAGCA
GCTGGACGACTACGCACGGCAGAACCGCGACTTCCCGCCGCCATCGACGCGGCCACAGAGCGTGTTGGTGATCACGGACC
GGTCGATGGACCTGATGGCGCCGCTGGTACACGAGTTTACGTACCAGGCGATGGCGCACGACCTGCTGCCGATCCGGGAG
GGCGACCGGACGCTCTTCCACATGATCATCAACGAGGGCACGGCCACGGCCGAGGAGAAGGACATGGAGCTGCAGGAGAA
GGACAGCGTCTGGGTGGACAACCGGCACCGGCACATGAAGGACACGATCGACAAGCTGATGGGTGACTTTCAAAAGTTCT
TGGACCAGAACCCGCACTTTACGGACGCGGCCGCCGACACGACGAACCTGAACGCGATCAAGGACATGCTGGCGGGACTG
CCGCAGTTCCAGGAGATGAAGGAGGCATACTCGCTGCACCTGACGATGGCACAGGAGTGCATGAGCCAGTTCCAACAGCA
CAAGCTGCCGGACGTGGCCTCGGTTGAGCAGACCATGGCTACGGGGCTGGATGAGGACTACCGCAAGCCGCGCGACCTGC
TGGACCAGGTGGTGCGGCTGCTGGACGACGATGCCATCCTGAAGGAGGACCGGCAGCGCCTGATCATGCTGTACGTGCTG
TACCGCGACGGCGTGGTGGCCGAGGACGTGCGGCGCCTGCTGGCACACGCAGGCCTGCCGCCAACCACTTTTGACAGCAT
CGTCAACCTAGAGCTGCTGGGCGGCCGGCCGGTGCGGGCGAACCTCAAGGACGTGCGCCAGCCTCCGCCACAGGCTCTGT
TCCCGGTCGACCCCAAGGTAGCGCTGGCAGCGGCCCAGGCGGCCGGCGAGGACGGCTATGCGCTCTCGCGCTTCGAGCCG
GCCGTGCAGCAGCTTCTGGATCGTCTGTGCCGCGGCCAGCTGGACCAGGCCGTGTTTCCGTACGTCAACCCGCCGGCTGA
CCCGAATGAGGACGCGGCGCTGGCGGCCGCAGCCATGGGCTCTCTGCGAGCAGCGAAGCCCAGTTGGGCCGGCACCAATC
GACGAGTGCCCGACAATCGCCAGCGTGTCTTTGTGTTTGTGGCCGGCGGCGCCACCTTTTCCGAGGCTCGTGCCTGTTAC
GAAGCCTCGACTCGCCACGGCCGCGACGTCGTTCTGGCCACGAGCCATATGCTGACGCCCAGTTTGTTTCTGCGCCAGCT
CGCCGACCTCTCGGCCGATTTCCGCAAGCTCGACATTCCCCTGGCCCGTCCTCCGCCCAAGCCGCCGGCACATCTGTTTG
AGCGCGACCCACCGCCAAAGCCGCAGCCACCGCCACCACAGTCGCTGCCAGCTCGGCCTGGCGTGGGTGTGGGCGTCGGC
GGCGGTCCGGGCATGGCAGGTCGAGCACCATCACGGCCTGGTGGTCCAGTCGGACCGGGTGCTCCGGGTACTTCGAGTGG
TGGAGGACCACAGCCGCCGACCAAGCAGTTTGGCCATATGGCGCTTGGTAGCGGCGGCAGCAGCTCGCATCTCCCGGTCA
ACGGTGCAGGCGGCGACCATAAGCCGCACAAGGACAAGAAGAAGCGGAACCTGTTTGGACTGAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62