GenePrediction:GLEAN_5114 Details

Name: GLEAN_5114
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1751790..1748703 (- strand)
Length: 3088
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1751790..1751288 (- strand)
Length: 503
Type: CDS
Source: GLEAN
Position: GCSC_97:1751163..1748703 (- strand)
Length: 2461
>GLEAN_5114 class=GenePrediction position=GCSC_97:1751790..1748703 (- strand)
ATGGCCCGCAGCTCGAGCTCGGCCGTGCCGGTGCTGCCGCTGCCCAAGGGCGTGGTCCTCTTTCCGGGCATCATCCAGCA
GATCCCCGTGACGGCCAGCCGGCCCGACATTCCGGCCCTCTTGGCGAGCATATACGCCCACGCGGCGAACAAGTCGACGG
GCGATGGAGGCGCAGCCGCCATCAATGCAGTGCCTATCGCCTGCATCCCCATGGCGTCGCCGTTTGTCGGACCGCGCGGC
CAGCTGCTGCTCGGCCGAGACACCAGCAGCACAAACAGCACAAACAGCACAGCCAACCCCGGCACACCGCCAGGCGACGC
GCCCGAGTTCGTCGCCGGCAAGTCCACCAAGGCCGACCTCTTCAGCTGCGGCGTGGTGGCCAACATCACCAGCATCGAGG
GCCGTGGGGCCGGCGAGTTCATGCTGCACGTCGAGGGTCGATCGCGCGTGTGGATCGACAAGATGGTGCAGGAGCAGCCG
TGTTTTGAGGCCAAGGCGACGGTGTATGCTGACGAGAGTAGGTTTTTTTTCTCTTTTTTCTCTTTTTTCTCTTTTTTCCT
TTTTTTTCCTTTTTTTTCCTCTTTCTTCTCTCTTTCCCGCTAACCATACAGTCAACACGGCCGACAGCGGCCTGGTCGAG
GTCTTTGAGAAGCTCAAGAATGCGTCCCGCGAGCTGGCCCAGATCCTGCGCATGGCCGCGTTCGTCTCGCCCGGACGGCC
ACACTCACGGCTCACGCCGATGCTGGCCCGCCGGCTCGACTCGTACATCCGCAGCAAGACAGCAGCCGATGCGGGCGTGC
TGGCCGACTTCATGGCCAACATCGTGGTGGCCTCGTACGAGGAGAAGCTGCAGGTGTTGGTGCTATTCGACGTCAAGAAG
CGGGTGGCCAAGGTGCTCGAGCTGCTAGAGCGCCAGGTCGGCAACATCCGCAATAGCGTCAAGTTCACCACCATCACCGT
CGAGACCACCGACGGCGACCAGCAAGACGGGCCCCAACCGCTGGTTCCCCGGAGCCAGGGCCTGCCGTTTGGCGTCATCG
TGCCGCCCGGCAGCCCGCTCGGCCACAACAACAACAGCCACAACGGCATCGTCCCGATCGGTGGCAGCGGGCTCTTTGGT
CCCGGCGGTGCCTTCCGCCAGAAAATGGGACAGCACGGCCAGCGGCCTCAACCGCCGCCAGAACAGCGCGAGCCGGACGA
GATCGAGGAGCTAGCCCAGAAACTCGATGCGGTCGGCCTCAGCGCCGAGGCGGCCAAGGTGGCCGAGCGCGAGCTCAAGC
GGCTGCGCAAGATGGTCCCGGCCCAGGCCGAATACACGGTTGTTCGGAGCTACCTCGAAACGCTGGCCGAGATTCCCTGG
TCGGCCGTGACGGAGGACCGGTTGGGACCCGGCACGCTGGCCAAGGCCCGGGCCCAGCTCGACAGCGACCACTACGGGCT
CGAAAAGGTCAAGAAGCGTCTGCTCGAGTACCTGGCCGTGCTACGGCTCAAGCAGTCGGTCAACGAGGAGATCGACGTTG
AGGCCAAAACAATACAACAGGAGCTGGAGCAGGCGCAGGCAAGGATGGCTGAAGAGACTGATGAGTCAGCACAAATGGCT
GAGTCAGCACAAACGACAACCGAGGCACACAAGGCCGCACAGCAGCAGGTAGAAACGGCCATGGCCCGACTCGACGAGCT
GCAGAAGCGACGGATGCTGGACAAGTCGCCGATCCTACTGCTGGTGGGACCGCCAGGTGTAGGCAAGACGAGCCTGGCAC
GATCGGTGGCAACGTCGCTGGGCCGCAAGTTCCACCGGGTGTCGCTGGGCGGCGTGCGGGACGAGGCCGAGATTCGCGGC
CACCGACGGACATATGTGGCCGCCATGCCCGGGCTGATTATGCAAGGACTGCGCAAGGTGGGTGTGGCCAACCCGGTGAT
GCTGCTGGACGAGATCGACAAGGTGGGCACGTCCAACTACCACGGCGACCCATCAGCAGCGATGCTGGAGGTGCTGGACC
CGGAGCAGAACCAGGCGTTTGTGGACCACTACCTGTCGCTTCCCTACGACCTGAGCCGGGTGGTGTTTATCGCGACGGCC
AACAGCCTGGACACGATTCCGGGGCCGCTGCTGGACCGGATGGAGACGATCCAGCTGCCGGGCTACACGACGCTGGAGAA
GAAGCACATTGCGATGCAGTACCTGGTGCCGAAGCAGATCCGGGCGAACGGACTGACGGCGACACAAGTAAGCCTGGACG
AGGCTGTGGTGGCCCGGGTGATCGAATCGTACACGCGCGAGGCCGGCGTGCGCAACCTGGAGCGCGAGCTGGGGTCGGTA
TGCCGGGCGAAGGCGGTGGAGTACGCCGAAGCCAAGGACGGCGGACGACTGGAGATGTACCGATCCCGGCTGACGGTAGA
GGACCTGGAGGGCATCTTGGGATCGGAAAAGTTTGAGGAGGAGATTGCAGAGCAGACGAGCCGACCGGGCGTGGTGACGG
GACTGGTGGCCTACAGCTCGGGCGGCAACGGCAGCATACTCTTCATCGAGGTGGCAGCGATGCCGGCAGGCGGCAGCGGC
GGTGGCGGTGGCCGCGTGCAGCTGACGGGCAAGCTGGGCGACGTGCTCAAGGAGAGCGTCGAGGTGGCGCTGTCTTGGGT
GCGGGCGCACGCGACGGACCTGGGCTTGTCACGTGACCCGTCCGAAGACATTCTCCGAAACCGCAGCATCCACGTGCACT
GTCCGTCGGGATCGATTCCCAAGGACGGTCCCAGCAGCGGTGTGGCGCAGGCGATCGCGCTCATCTCGCTCTTCTCCGAC
CGTGCCGTGCCGCCGAGTCTGGCCATGACGGGTGAGCTGACGCTGCGCGGCCGCGTCACCGCCGTCGGCGGCATCAAGGA
GAAGCTGATTGGCGCTCTGCGTGCCGGCGTCAAGACGGTCCTGCTGCCGGCCCAGAACCGCAAGGACGTGCGCGATCTGC
CGGACGAGGTTCGTGCCGGACTCGCCATCGTGTACGTGAGCCACGTCTGGGACGCCATCCGGCACGTCTGGCCCGACGTC
CGCTTTCCCGGAGCCGAACGGCTCGCCGCCGTCGAGAGCCGGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62