GenePrediction:GLEAN_5115 Details

Name: GLEAN_5115
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1732558..1730048 (- strand)
Length: 2511
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1732558..1731750 (- strand)
Length: 809
Type: CDS
Source: GLEAN
Position: GCSC_97:1731589..1731582 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_97:1731303..1731090 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_97:1731008..1730048 (- strand)
Length: 961
>GLEAN_5115 class=GenePrediction position=GCSC_97:1732558..1730048 (- strand)
ATGCAAACCCTAACATCGACGTATCATCTCCGTCTCGCAGAGCCACAGACCTCGCTCGGCCGGCGCCGAGACTGTTTAGA
TCTGGCACGCTTCTCCCTGGACCTGACCTGGGCACGGGCAGAGTCGGAACGTGCTGCTCGAGCGAAGGCCTACCCGTCTC
CGCCCATGTCAGGGTCTCCTCCACTTCCGTCCAAACCAACTCACGAGGCTGGTGGCTGGAGCCAGGGACGACAACAGAGT
ACGAGCCACGATGCCTATCGAGGATCTGCCTTGACGACAGCAAGCATCGCAGACGTCCACAGACCTGCTATCATACAGCA
GCCGCAGCAGCAGCAACAACAACAACAACAACACCGTTCCTCAGTAGATTCGTACGCCCATCCACACCCACACTCACATG
CGCAACAGCATCAATATCAGCAGCAGCAGCCACCACCACCGCCAACGCAAACGCCACTCTCGTATCCGAGACCGTACTCG
CTCTATTCTCGCTCTGAAGATCCCTCTGACCCCCGTTCGATGTCTTCTTCCGCCTACGCTTCGCCACAGCTCCTGGACCC
AGCAATGCCGGCACACCTCCCTTACCTGCCCCCCTTGCCAGGTCCGGGACCGATGCAGCAAGGCTACCCCATTTCTGTCC
CGAGCCGGCCGCCACCGCCATCACAAGTTCCTTCTCCGAATTCAGTTTCCGCTCCGGGCCCTTCGGGGAGAGAGGATTCC
ATCCAGCCGTTTGACTCTCCCAAGTCTCAGAGAAAGACCAAAGGGCACGTGGCATCCGCTTGCGTGCCCTGCAAAAGAGC
CCATCTGCGGTAAGTCAGTTCCCAACGCCTGGTTTGATCGAGGACGTGCCGTGCCTTTGTGCTTTTGATTTTATATCTGG
CTTTTTCCGTTTTTGTTTTCGTTCTTTCCCGCTTTCCAGCTTCCTCCCTGAAATGCCGATGATCTGACATAGTGGCTTTT
GATTTGCAGGTGTGATTGTACGTACGACCAATTAATCGTCCAGTGTTTATTACCCCATGGCGACGAGGGGCTGGTTTAAA
ACCGCCCCTTGCTGCACAGCGATCAATTTCTCGATTTTACCATAAACATCTTTCCTCTCCCATTGTCGTTATCCTTCGGT
GCATACCCCTTGTCACAGACATTCGATTCTCGACCCTGTCTAGACGAGTGCTTCGTTGTCAAGGCGGCGTCTGAATTTTC
TTTCCAGGCTGAATTGGCCCGCAAGTTTTTATACACTAACTAACACGCGAGATAGCACAACGGCCCTGCTCTCGTTGCTT
GAGCAACAACAAGGAGGATGCCTGTGTCGACGTTCAGCACAAGAAACGGGGACGTCCACGACTCCGCGAGGAGAGGGACT
TGAGGTACGATCTTTCAGGGAGAGGTGGCCCAGGCGGGCATCCGGCCGAGTCGGCATTGCACAGGCCGCAGATTCTATAT
GGACAATCCCCTTCATCCATGGGCACAGGGTACGGTATCGCAACGCGACGAAGCAATTCTTCCTCACACAGGATAATAAA
GTTTCAGCCTGCTGACTTTATGGCTCCAAGGTTTATCGAGCGCGGTGGCTTGGCCGAAGCAAACGTTTATTCGGCTCCTC
CTTCGATTTCTACCATGCACCCCGTGCCAGCTGCCTATCTTACCATGAATCTGGGGATCACCAAGGCGTCCAGCTCGTTT
TCAGATGCTGTCGGGCACCAAAATACGATTGGGTTGAATCTCCGGGATTTGACTCTACCTGCGGACGACAGAAGCCTACA
GACACTGCTGCACCAGATGCATGACGAACGAAGACGAAAAGACCCGCAATATCTGCCACCAATTTTTCCGGAGCGAGAAC
AAGACAGAGTCATCCAGGCTCTCGGATTCAGTTCAGACGACATGGCCCGATTCTCGTTGGATCGGCCGGAGTATATCACG
TTCCGATCTCAGGATGGCCAGCAGAGGGGATTCCGCGCGCAATTCGGACTGGCTAAACAAGATTCGATATACTTTATCGT
CCTCTTATTACATGTGGAAATGCGGTCGTTCGGACATCCTACGCCGTCGCCACAGTCGCGGGAAGTGCCATACGCGTACC
CGCCCTTGCAGCATCCACCTCAGCATCAAGCATTTTCCCATTCGACGCCGGTGGCGGCAACCTTTGACGTTACCCGCTCA
AGGCTCGCCACCGATCTTGGGTCGGGCCCTGCTCTACACCCACCGCCTCCCTCGGGACCAGTGATGGCGGTCCTCAGCCC
CGCTTTGCCCTCCACCTATTCCGCCTTCTCGAGTAGATCTGAGTATCTGGCAGGGCCCTCTTCTTATCAGACTCCAAGAA
GTGCGCCAGGCCTAGTTGCACAGCCTCATCAGCAGCAACCACCATCTAGCTACCAGCTGCCACCGATACGCAGCCGACAC
GAAGCCAGACCGTTGGAGTTTCTTCCCACGACGAGAGACGACAAGACGCGGGTCGACATAGGCGGACTGATTGACAAACC
GGAGCCTTTAGACAGACGCCCGAGCCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62