GenePrediction:GLEAN_5116 Details

Name: GLEAN_5116
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1725093..1721466 (- strand)
Length: 3628
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1725093..1724937 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_97:1724884..1721466 (- strand)
Length: 3419
>GLEAN_5116 class=GenePrediction position=GCSC_97:1725093..1721466 (- strand)
ATGCGGAAGAGGAGGTCAACCGCTCCGGAAGGAGACGGTGTAGCCAGGAAGAGGATTCGAGTGGTGCACGAGGCACCGAC
GTTTGAAGCCATTCTCTCGGCGAGACAACTGATGCAGCTCCTGTCCTTTGACCAGGACATCCAGAAGGCTCGCCATGGTG
AGCCAACTTTCCCTTGTTCTGGGGAGCTGGGCGCTAATTTCAATCGCAGGACTGCAATCGTTCAAAGTGCTTCTAGACCG
CATCAATGACGCCGAAAAGCGCACGCCAGAAGATGTCGCCATTCTGCATGGCTACCTCCGATCGACCAGTCCGAGGACGG
AGAGCAACGGTGACAACGGCGATGATGCAGACAACACCGAACCCGTCTTTCTCGCAGATATCATGGACAGCTGGAGCTTT
GCTGCAAAACTGGACAACGACAGCGTCAGGTCGGCCGTGCCCGTGGTGCTGGCTCTGCTGCTCAAGTATATATCACATGT
GCTCGAGCTGGCTCCCATTGGCCTCGGAATCTGCCGCACGCTGCTTCTGCCGCAGCAGCTGGACTTGATCGCCAAGAACC
TGTCGGCCGAAAAGAGCAAGGAGTTTATCATATCACCGACTTTGCGCATGCTGCGCGAGGTCGTCACGTTTGATGGTGGT
GCCGTGGCCAAGGCCCTTTTCCGTGCGCGAAACTTCACATTCCGCCTGCTGGCCCGGAACATGGGCATCAAGTTCCTGGG
AGAAGGCATCGAAGACGCAAAGAGGACATCGGCGCGGACAAACGCGGTCCGATTCTTCCTGGCGACTCTCAAGTTCCTCC
ACCCTGAGGCCAAGGCCGAACTTCTCTCTCAGCGCGATATTGTCGGAGCCTTGACGAGGACGATCAGAGACGACCCACCG
TACGTGGTGCATGATCTTCTGGAGAGCCTGCAGAGCCATGTGATGCGCGACAGGAAGTTGTCGAGAATGGTAAAGGCAAG
GCTGCTCAACTCGGCAACGCTCGTTCAGATTGCCAGCCTCTACAGTTATGCACACGACAACAGCGCGGCTGCTGATGACG
AGGAATCTGGTGGAGCCAACCGGACTTCCGTCTCGGATGCTGCTCACCAGTTTCTGCTGCACGCATGCACGTCGCCAACC
GCGGGTGTTCTGCGAGACCAGTACGGCTGCTACCCCAAGGGCGCAGAGCCGGACACAGCTCCATCAACTGTCTCGACAGC
CAACACAGATCCCCTGGGCAGCGGAGGCGGAAGTGGTCTCGACCGAATCGTGTGGATGGACAAGTTTATCAACGAGGTGC
CTGTGCACAATCTGGCTCTGTCCGACCTCATCGCCACATTGCGGCCGTGGTACAGCACGCGGCAGAGCGAGCTGCTGATC
GCCGTTTTCAAGGAAGCCCCAGAGCTCATAGCCTGGTACTTTATCAACAAGAAGTCGTTCACCTTCGAGCCCAAGATCTC
GGCCACCTGGGTCGGCTTCTCTACGCTCTTGTTCAATACCATCCGCGTGGACTTGCCCCCGTACTTTGGCAGCCGGCAGA
AGTATGCACACATTCCGCCGCCGACTTCGGTCGTCGTGGACAACATCCTTCCCCTGCCCCTGTCACAGAAGATTCTTGGG
CGTTGCCTGAACCACAAGTCGAAGCTGGCCCCGTTCTTCGCCGTCCGCTTGCTCGCAATCTCCCTCGAGAAGCTTCGCGC
GGCTCTCCAGATGCACGACGAGGCCGCAAAGAGTTACCCGGCCGAGTCCCTCTGGGCGGAGTCTTCTCGCAGGGTCATCG
ACGAGTTCTGCCGTCGGTGTTCGCCCATGAAAGACATCATCAACACCTACCGGGGTATTGCCGAAGACGATCTTCTCTAC
CGCGAGGCGGCCAGCCGCGTGCTGCGTCTCTGCTACGAAGTCACCCCCCAGGTGGCCTTACTGGCCAGGTTTGACGTGTC
CTCCTCTCTCTTCACCGTACTTCGCCAGGCGAATCAGTACGAAGGCTCACCCCAGGACAAGGTGCTCAAGCTGATGGAGC
TCGAAAATCTCCTGGCCATTGCCGGATACTCGCCGGCTATGCGGTGGTTTTCCAAGGCGGAAGGCCTCACTACGTCGCCG
TTTGTGGCGCTCGTCAAGGTCTACACAGAAGCGCCTGCCGACTTGGTTCTGAACAAAGTTCGAGAGATGCTCGAATTCGT
GGCAAGAGAGCAGGAAATCGTGCTGTCTGCAGCCGGCTCTTCTGGCCTGTCAGCACTGTTCGGCAGCTTGCAGCAACTAC
TACAAACAGGTGCAACACCCTCAACCGACTCTGTCTGGACGTTTGTCGACAATTGTGCCGTCCGCTGTGCCATGGCTCCG
ATCAAGTACATTGAAATGCTGCAAGACCTTTCCGGGGAGGGAGCGAAAAGCGGCGATGCAGTCGATCCGATCACGATGAC
CATAGCCGAGCAGCTGTCCTTTGCTACTGCCAACGGTGCAAGCGAAGCCACGCTGAACTCCCTTGCCGACTTTGTTCTGC
GGTATTTTGAGGGTTGCAGCGGCAGCAAAACGTCTCTCAAACCCATTTTCAAGAAAGCTTCGAGTGCCTTCCCAGATGGA
TCACGTGCTGCGGCTAAGCTGGCTAAAGGCCTGCCAAAACGGTCCTCCAAGGCCAAAGAACGGTCGAGTCCGGCGTCGGG
TGAGGATGCCGCTGCGGACGACAGCAAGACATCCGAGAAGGCAGGAGGCGCCAAAGATAACTTGGACGACCAGGAGTCAT
TAGAGGATCTGCTGGAGCTGGCGCCGGTTTCCGAGCTGGACAACGCAGCACTCGCCAAATGGGCCAATCGGCCGGCCGAC
GAGCTGGTCGAAGAAGGCTATGCGGCATCGCTGATCATGCTGCTGGCATCCGAGCACACCAGCATACGGAAAGAGGCGCT
TGTGAACCTGGCCAAGATGGCGGCCAAGATCCGAGAGTCGACGTATGCCGAGAAGGACCAGACCTGGCTGCTGCTGTCCG
AGCTGGTTGCGTCTGCTCGGGCATGGACGGCCGACCAGGACACGGCGAACCTGCCTCTGCCCAGCCATATCCTGTCGTTT
GCATGCCATGCCTTGGATGCGCTGCGCAATCCGTTGCACCGGCTCTACGGCAAGGTGAACGCATTCTTGACGGCCGGCCC
GATTTGGCGACTCGGAAACTTCCCACTCGTGCACAACATTGTGCATGACGGGCCGACGGAAGACGACTCCTACTACGCCG
AGATTAACTGGCTGCTGGCCTATCTGCTCGACAGCCTGCGGACGCCGGCAGACGTCGGCCTCTTCCGGACGCGGAGACTC
TTTGAGACCATGCTGTCGGTGGCCTCGAACCCATACCTGCGCTTCCCACTTCGGCGACAGGTGCTGCGGATCCTGTGCCG
GGCAGCATCGATCGAGGGCGGCAGCACCACATTGATCACGCGGTCCGGCATCATCAGCTGGCTTGCTGCGCGCAAGGCGA
CAGCGGCCGGCGAGGACGACAAGCCCATGGCGGCAGAACGTGCCACAGATGCCAAGGGCGACGGAGAGGAGGCACGCATT
GTTCGGGCACTCCTGCAGAGGCTGTGGGAAACCAGCGACCAGGAGCGCGTGGAAAACTGGAGCATGCACGGCATACAGGA
AAGCATCCGTAATTTACGTACTTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62