GenePrediction:GLEAN_5119 Details

Name: GLEAN_5119
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1715830..1713609 (- strand)
Length: 2222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1715830..1715822 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_97:1715739..1715560 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_97:1715507..1713609 (- strand)
Length: 1899
>GLEAN_5119 class=GenePrediction position=GCSC_97:1715830..1713609 (- strand)
ATGGTGTGGGTGCGTCGGGGCCGCGGCGAATCAAGGCAAGCCGCCACGTGCACCGTCCCGGCCGTGCTGTCTCTGCTGAC
CGACGTTGCAGGCGCTCGACCCGGACGTGGTGAACAAGATTGCGGCGGGCGAGATCATCATCGCGCCGGTGCACGCGCTC
AAGGAGCTGGTCGAGAACGCGGTAGACGCGGGCTCGACGATGCTGGAGGTGCTCGTCAAGGACGGCGGCCTGAAGCTGCT
GCAGATCACGGACAACGGATGCGGCATCGATGTGAGGGCCATTCCGTCTGGTCGTCTGTCCAAGCTGTGCTGACATGAAG
CAGAAGGGCGACCTGCCGATTCTGTGCGAGCGCTTCACGACGTCCAAGCTGCAGACGTTTGACGATCTCGGCTCGATCGC
GACATACGGCTTCCGGGGCGAAGCGCTGGCCAGCATCAGTCACATTGCCCATCTGACGGTGACGACGCGAACACGGGACG
ACGTGTCGGCCTGGCGAGCCTGCTACGAGGCCGGCCGTCTGGCGCCACCGAAGCCGGGCCAGGACGCCGAGCCGAAGCGG
GTGGCCGGCCGCCAGGGCACCCAGATCGCCGTCGAGGACCTGTTTTACAACGTGCCGACACGTCGACGTGCCTTTCGCTC
CGCCGCCGACGAGCACAATAAGATCGTCGACATGCTCGGCCGCTACGCCGTCCACTGCGCCGGCGTCGCCTTTTCCTGCA
AGAAGCACGGCGAGTCGTCCGCCAGCATCGCCGTCCCGGCCGTCGCCACTACGGTCGATCGCATCCGCCACGTCTACGGC
GGCGCCATGGCGGCCGAGCTGCTCGCCCTCGACACGGCTGACGTCCGCTGGGGCTTCCGGGCTCGTGGCCAAGCCTCCAG
CGCGAACCACTCCCTCAAGCGGACCACCCTGCTGCTCTTTATCAACAACCGCTGCGTCGAGTCGGCCAACATCCGCAAGG
CCCTCGACGACCTGTATGCCACCTTTCTGCCCCGACACGGCCATCCGTTCGTCTACCTCAGTCTCGATATCGACCCGCAG
CGCGTCGACGTCAACGTCCATCCGACCAAGCGCGAGGTCCATTTTCTGAACGAGGACGAGATCACCCGCGCCGTCTGCGA
CCACATCGCCTCCAAGCTGGCCGACGTCGACACCAGCCGCACCTTTGCCACCCAGACACTCTTGCCCACACGACTGCCCG
CTCCCAGTCCGGCTTTGGCCGTCAAGAAGACACCGGCCCGGCCGTACGAGAACAACCTCGTCCGGACAGACTCCAACTTG
CGCAAGATCACCAGCATGTTCACGCCCACATCACCGATGACCGTGTCATGTCCTGCAGCAGCAGAGACCGCCCCATCCGA
CGCTTCGGTCCATCCGGGTCGCCAGCCCGCATACGACGTGGTCGAGCGCGAACCATCGGTCAACTGGCTCAGGAGCGTGC
GCGAGCTCAAGGAGGCCGTCGTCGCCGACGCCCACGGCGGCCTGACCGACCTCTTTCGCCACTACAGCTTTGTCGGCATC
GTCGACGACCGGCGCCGTCTGGCTGCCATCCAGAGCGGCGTCAAGCTGTACCTCCTCGACTACGGTCGTGCCTGCTTCGA
GCTGTTCTACCAGCTGGGCCTCAACGACTTTGGCAACTTTGGCCTCATCCGCTTCAGTCCGCCGCTCGATCTCGCTCAGC
TGCTGCGCATGGCCCTCCGGCTCGCGCCCGGCAACGATGGCCATACGCCTAGCCCGGACGACACCAGCGCTGTCGATGCC
GTGCTCGCGCAGCTCGTCGAGCGCCGCCAGATGCTGCTCGAATACTTCTCGCTCGAACTCACGCCCACCGGCGAACTCCT
CAGCATCCCTATGCTGATTAAGGGCTATACCCCACCGCTGACTAAGCTGCCCCACTTCCTCCTCCGTCTCGGACCCGCCG
TCTGTTGGACGGACGAGAAGGCCTGCTTCGACACGCTGCTGCGCGAGCTGGCCCGCTTCTACGTGCCGGAGCAGCTGCCC
AACGAGGACGATGACGATGGCGGTGTTGACGACGACGACGGCGACGGCGACGACAGCGATGGCGAAATGCGGGCCCGCCG
AGCACATGTTCGCCATGCAGTCGAACACGTCTTCCTGCCGGCCTTCAAGGCCCAGCTGATCTGTACGGCGTCGCTGATGC
AGGCAGGCTTGGTCGAGGTGGCCAATCTCAAGGGCCTCTATCGCGTGTTTGAGCGCTGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62