GenePrediction:GLEAN_511 Details

Name: GLEAN_511
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:267887..269026 (+ strand)
Length: 1140
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:267887..267915 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_97:267972..268157 (+ strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_97:268313..268676 (+ strand)
Length: 364
Type: CDS
Source: GLEAN
Position: GCSC_97:268787..269026 (+ strand)
Length: 240
>GLEAN_511 class=GenePrediction position=GCSC_97:267887..269026 (+ strand)
ATGACGACAACTCTTGACGACCGACTTCGGTAAGCCTGAGCGACCATCTGACCGACAAAGACTACGACGCATTCGCATCG
CACAGCTCGCCGCAGAGACAGGCCGAGACCAGCTGGGGAGAGATTGCGCAACGCGACCCAAAGGCGACCGTACGGCATAT
ATACACCGAGGGGCCTGAGACCGTTCCCCATGCTGGCACCGTTGCGGCCTCTGCGCTCCGACCACCTGTCGCCATGGGGA
ATTCGGGAAGCCGGGTCACGGCCCAAGACAAGTGGGTAGCCCTGGAGGGAGGAGAAGAGAGGAGAGGAGAGGAGAGGAGA
GGAGAAGAGAGGAGAGAAGAGAGAAGGAGAGAGAAGAGGAAAGGAGAAAAGAAGGAGAAAAGGCGAGAAGAAGGGAAAAG
AGAGACAGATAACTGACTCTCCACAGGGCCATCTTAGACCTCAAGCTGCAGCGAGACCGACTACATCAGTACCAGCGGCG
GATCACGGTGCTGACGAACCGTGAGACCGAGATCGCCCGCCAGATGCTCGCCAAAGGCGACAAGAAGCGGGCGCTGCTAG
CGTTGCGGCGCAAAAAGTATCAGGAGTCGCTGTTAGCCAAGACAGACGGCCAGCTGGAGCAGCTGGAGAAGCTGACGTCC
AGCGTCGAGTTTGCCCTGATCCAGAAGGACGTCGTTTTTGGCCTGCAGCAGGGCACACACGTGCTGCAGGAGATCCATCG
CGAGATGGGCGGCATTGCACACGTAGAAAAGCTGATGGGCGAGACCGCCGAAGCTATTGCGTATCAGGACGTGCGTCTTC
GTCTTTGTCCTCTCTCTTTCTACTTTCTCAGTTTTCCTCCCTCTTTTGTCTCCTCCATCCCTCTTCTTTTCCTTATTTCC
CCCACACTAACCATTTACAGGAGGTGAGCGAGATGCTGGGTGGCCGTATGTCCAACGCCGACGAGGACGAGGTCGAAGAC
GAGCTGGCCGCGCTAGAAGCCCAGATGATGCCTGCAGGCCGCACACCAGCCGAACTAGCCCCGGCAGCACCGGTCCAGGA
ACCAATGCCCAACGCCCCAGACACCCAGCTGGTCAGTCCGGAAGGACAGGCCGGGACGGCAGACGCACAAGCAGAGCGGC
GACGCTTGGTGGCCGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62