GenePrediction:GLEAN_5120 Details

Name: GLEAN_5120
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1709837..1708488 (- strand)
Length: 1350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1709837..1709775 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_97:1709715..1708864 (- strand)
Length: 852
Type: CDS
Source: GLEAN
Position: GCSC_97:1708514..1708488 (- strand)
Length: 27
>GLEAN_5120 class=GenePrediction position=GCSC_97:1709837..1708488 (- strand)
ATGAAATTAGACACAAAGCATCTGCGCTACCTCACACCAGAGGATTGGCGAGTTTTGACTGCGGTATGAATGTCTGTGCC
CCATATTCAAGGACAATCACTTATTGTGTCTTCGATTTCTAGGTGGAACTGGGAAGCAAGAATCATGAGATTGTTCCCAC
ATCTATCATCGATAGGACCGCACGGCTCCGTGGTGGTAGCAGTGGTGTGAACAGAAGTATCTCGACACTTGCCAAGGCTG
GTTTGATCGGACGAGTCAAAGAAGCGTCTTACGACGGGTACCGGTTGACATATGGTGGCCTGGACTACCTTTCTCTGCAC
ACGCACGTGCAGCGCGATGTAGTATACAGCGTCGGCCACCGGGTTGGTGTGGGGAAGGAGAGCGACATTGTCATGGTAGC
CGATCCAAAGGGCCGCCAACTGATTCTCAAGATCCACCGACTGGGTCGCATTTCGTTCCGCACCGTCAAGTCAAATCGCG
ACTACTTAAAAAAGCGCCAGTCTCGGGGGTCGTGGATGTACCTCTCCCGGCTGTCGGCCATGAAGGAGTATGCCTTCATG
GTCGCTCTGCGCGAGCAAGGGTTCATTGTGCCCGAGCCTATCGCCCAATCACGACACACAATTGTCATGTCCTTTATTGA
CGATGCGCTTCCGCTGCGCCAAGTATCCAGTGTTCCTGACCCGGCCGGTCTCTATGCGGAATTAATAGGCCTCATTCTTC
GTCTGGCTAGCCACGGCTTGATTCATGGCGACTTCAACGAGTTCAACATTCTCATTCAGGAGCAAAAGGTCGAAAAGGAC
GTAGCCGGAGGGGAGTCCGGCGGCTCAAATGGCACAGATGACGAGGAAGTCATTCTCGTCCCCGTTCTCATCGATTTCCC
GCAGATGCTGTCTATGGAACACAAGAACGCCGAAATGTACTTCGACCGTGATGTGGCCTGTGTGAAGCGCTTTTTCGAGC
GTCGCTTCCACTTTGTGAGCACACAGCCTGGACCATTTTTCAAAGAAGCACAATCATATATTGGTCGCAACGGTGCACAT
CGCATTGATGCTGCCGTTGAAGCTACTGGCTTCACAAAGAAAATGACCAAGGATCTGGAAGCTGCCATTTTGGAACAAGC
TACCATTTCTAATGAAAACGGTGGCCCAGATGATGACGATGATGATGACGACAGTGACGACGACGAGGCCGATGAAGAAG
ATGATGACGAAACAGAAATTGGAACAGAACAAACGCGTGAAGAACCTGTTACGGTGTTTGATGGAGAGGATACTTCAGTT
CATGAGATCACTGTAAGTTTGCCGAAGCTTGGCTTAAAGACAGAGACATGACGAGATGGAGGGCAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62