GenePrediction:GLEAN_5121 Details

Name: GLEAN_5121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1698630..1689304 (- strand)
Length: 9327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1698630..1698595 (- strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_97:1698464..1698246 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_97:1698001..1697066 (- strand)
Length: 936
Type: CDS
Source: GLEAN
Position: GCSC_97:1696986..1689304 (- strand)
Length: 7683
>GLEAN_5121 class=GenePrediction position=GCSC_97:1698630..1689304 (- strand)
ATGACACAACTGATCTCGACGAACCTGGTCCTCCGCGTGTGCAGAGCATGGATCTACAAGTACTCGACATTGGCATCCTT
AGAACCGCAGCCGGCCGCTTAGTGGATAATCGCCCAATCACCGTCTAGCTCGACCGACTCTCGATTTTCGCGCGCCTTTG
CACAAGGAGGAACAACCCAACGCCATCGGTCTGGCTATTCTCTGCCACCACCCCCTCCTTCCGTGCTCCGACGATTGCGG
CCAAGGGAAGCTGCAGAGAGTGCTGCAGACAGCTGCAGCAAGCCGAGCCCGGTCAGACTACGAGGCCACGGGCACAGGCA
ACGGAACGACGGGCGCCTTGCGCTCGAACATGGGAAGTTGGGTGGTTGAGGCTGACAAAACATGGGTGAGTCGTCGCTTT
TCTCTGCTGTCGTGGGCCTCGAGCGGCTGTGAAACGAGGAGAGTGGAGGGGCGGGCTGTTCCCTTGTCTATTGGCGTATT
TGGTGGTGTGCTTCGGGTCCGCTTCTGTGGACGGGAAGACAGACGAGGCCAGCCTTGCCTGGTGGTGATGCATTCGTACT
CACACGCACACTCACACTCACACTTACGCCTACACTCGTCATCTTTACGTGATCTGAAAACTGACTTAGGACGACGATTC
TGCCTCTTTAGCTCCGTCCCAGACGCTGCCCGAACATGCATCTGAACAGCTCAAGTTTTCCGCTACACCCGTCACGCGCC
TAGTCGAAGAAGAGGAAGAAGACGACGGCTGGAACAGGACGCTCCGACCGGCAGCCCTCGAACTTCCGCCGGCCGGCCCG
CGACTGGCACCGCTATCGCAGAGGATCGCCCATTCGCGCGAGTCCAGCGCGGAGAAACTCGTACAGCTGCAGTCAGCAGC
AGCTGGCATCGCAGGTACTGCTTCTGTGCCATCGCCATCAGGTCTACACGCGCCGTCCCCCCGGACAGCCCTGAACGGGG
TGATTGAACGCGTCGTTGATCCCAAGGCTGCAGCGTATGGCCACCACCGACAGACGTCGATCGTCCACGGCATACAGCAC
TCGCGGAATGGAAGTCATTCTAGCTCGACTTCCAGCCCTCTCAGCCCACAGATGATAGCAGCCGCTGGTGCCGCTCTAGT
TGCCGAACGATCGGAAATGCAGCCTTCTGCTATGCGTCTTGAAGGAGACGTGTCGGTGCCGGCAGCGGCCATTTCTCCGT
CGCCGAGCGTGACGTCGACGTCGCGTCCCCCGACAGCGATGTCGGGCACGACGGCGGTCTCGGTACCCATGTCTGCGTCA
GGAAGTGGAGGTGGAAATGGGGGTGGGAGCGGGACCGGAACCGGAACCGGAACAGCCGGTGGAGGCGGCGGACTTGGCGC
CGGCCCTGGTCCCGTGGTCCCAGAGAGAACGTCATCTGTGGCGGATGGCGGGACGCCCAGCCATGCTCCAGCGCAACGGA
AACTCGAGCGTATGCACAGCGGAAAGTACCGCCATGAGCATTCGCACCATCATTCGCACTCACGCCACCACAAGGACGAC
CAAAAGACGGTGGGCGAATATGCGCTCCACGTGCTCTTCACCTCTGTGAGTGACGGGCGAGAGGCAGGCGGCGGCCAGAG
CAACTGGACGGGGAATGTGAGCTGACCGTGGACTGTTGTTGCAGTTTATCGCGATTGCGGAAGAGAAGCTGAGCGAGTGC
GTGTCGTCTCCCTTTGAGTCGGAGCCGCACGTGGAGCAGATCTGCGGGCCCGGAGTCGATGCGGCGTTTGATCACCACCT
CGCAGCACTTGGGCACATTGCCAAGCAGAAGCCCAAGCCGCTGATCGACTCGATGATGCTGTGGCGCAAGAACAAGAGCG
ATGCGGCCAACGAGGCACGAGCACAGCTGCAGCAGGCGCGAGCACAGATGGGGCCGACGCCGCTGCAGCGACGCAACACG
GAGCCGCTGCAGATGCTGTCAGCCAACGGAGCGCTAGACAGCGGAGGGCTAGGCTCGACGACGCTGGCGGTGAAGCAGGA
GGTAGTGGCCCAAGCGGAGCGGTGCTCGACGGTGTCGATCTACGTGCTGTGCCGGGTGCTGTTGGAGGTGATCACACAGA
GCAGCCTGGCATCGATCACGCCGGAGATGGAAGACAAGTTGGAGGCGATCATCTTTGGGCAGCTGAAGATGGCGGACGCG
GAGCAGCTGATGATGTCGCCGCTGCGCAAGGCGAATTGGAACCTGTTTGCGGAGCTGCTGGGGGCGATGAGCGAGATCAG
CTTTACGTCGGTGACGGGCCGGTTCATCAACGACTTTGAGCGGGCGGTGCAGGAGACGAACGCGCGCAGTCCGGTGCTGG
CGAGCCGCAGCGACGCGGAGGACCGGATGGAGCTGGTGCTGAGCGGGATGAAGCATGTGCGGCTCAAGCTGGCGCCGGCA
GAGGCGTGGGATCAGTCGTGCGATTTCATGGTGGCTCTGGGTCGGCTCTTCAGCCGTTGTCACGGGCAGAAGGTCAAGGC
AGCGTTCTGCTACATTTTGGACCAGCTGATGCTGCCGGTGGCGGCGCGGGCGAGCAACAGCGACTTCACGCGGCCAAAAT
GGGGCGAGGTGCTGAGCACGATTGGGCCGCGGCTGGCGCAGATGTACATGAAGCCACGGCACTGGTCGGGAGCGTTTCCG
CTGACGGCGACGATGTTGTGCGCGTCGCCACCGGAAAGCTTCAGTACGCAGTGGCTGCAGCTGGTGTATCCGCTGCAAGC
GCGGCTGAAGGACCGGGTTTCGAAGCCGCTGTGCCTGCAGGTGCTATCGCGGCTGGTGTGGACGTATCTGTACCGGACGA
CGGACAGCCAGGCGAGCACGGTGCGGAAGCTAGAGGAGGTGCTGAAGCTGGTGCTGCCGAACACGAAGCGACCGATCGTG
GCGGCAGAATGGTCGGTGGTGGAGCCGCTGATCCAGATCATTCGGCTGATCGGGTTCAAGCACCCGGACTACTGCTTCAA
GTCGATCATCTTCCCACTAGTGAACGCGGAGCTGTACGGGTCGTCGCCGGGACGCGAGGTGCGGGTCGAGCAGCTGGAGC
CGGACAAGATCGTGGTGGGCATCCGGGCCTTTCTAGCAGTGGTAGGCGACCTGGAACGCGGCGAGAAGGGACGGCCGCCA
TTTCCGCAGACCTACGGGGGTCCGCCGACGATGTCGGGCGATGGGTATGGCGATGGTGACGCAGGAAGTGGCAGTGGCAG
TGGCAGCAACAACGAGGACGACGCGTTGGGGCGGCCGATCGCGATGGCAGCGCTGAGTGACAGCGTGCGCGAGCACTGCG
TCCGGTTCTGCGAGATTCTGGGCCGGATAGCGATCCTCTGCGACGGGCTGTTTGGTGGTCAGGCGGCACTGGACGAGAAG
CACGGGGCGACGAGCACGAATGCGGGGCCGAAGACGCCGGGGCCGACGGAGACGACGTTCAACTTTACGCGGCGCGAGGA
GCAGCACGCAAACGCGCTGGAGCAGCAGAAGGCGGCGTTCTACGAGCTGCTGCACGTGGCGGTGCAGGCACTGCCGCGCT
GTCTGTCGGCGGCAGAGATGCCATTCCGCGGGCTGGTCAAGCTGCTCTGCACGGGAACGGCACACACAGAGGCGCAGATT
GCCGAGGCATCGGCACAATCGCTGCGGGCGATTGCACGGCAGCAGTCACACGCACGGCAGGTGACGACGAGCTTCTCACG
CTTCATCTTCACATTCGACAGCCAGTACGTCCCGGTATCGGACTCGGGGATGCTGGGGGCCGAGCAGATCGAGACGACGG
TGCGGCTATACGTGGAACTGCTGCAGATCTGGATCGAGGAGATCCGGCGGCGGGTCGAGGTCGAGGAGGCCGACGTGGCC
GGCATCTTGGCCGAGGCTGACCAGGTGGAAGCGCACGGGCTCTTCTTCCTGTGTTCGCAGTCGCGACGAGTGCGACGCCA
GGCGATCACGGTACTGCGACTGAAGGACGAGTTCGCGACAGCGCTGAATCGCAGAGCTCGGACGGACGAGCAGCAGCAGC
AGCAGCAGCAGCCGCGTGTGATTGAGGTGCTGGAGAAGGAGGCAGCGGCGATCATGGATCTGAACGATGAGTTTCTGACG
GTGGCCGAGCGCAGTCGGCTGCAGCGGGGGCTGAAGAACGGCGGGCGTCATGGGGCGGTGCTGGAGCTGTGCACGAGCGA
CCTGTCGTACGATGCGACGCTGTGGTTCAAGCTGTTCCCAAACCTAGTTCGTGTTGTCAGCGACCGGTGTCCGGCTGCGG
TGACTGTGGCACGTGACCTGGTGTGTGGCCGGATCCTGGAGATGTACAAGGCCGTGACGATCATCTCGGAGCCTCACCGC
GGCCTGTTTTCCGGAATCGAGCAGCAGCAACAGCAGCAACAGCAACAGCAGAACGGGCGGAACAACAGCCTGGCCAACAA
CAATAGCTACAACGGGTACAGCCAGCAGCCGGCAGCGCTACAGCTGCCAGAAAACCCAGAGCAGCTGGTAGAGCAGTGGC
GGCTGTTTCTGATGTTTGCATGCACGACGCTGTCGGAGCCGGGAAGCGGTCATCCGGGCGAGAGCGTGGACGAGCAGACG
CAGAGCACGGACGAGCATCCGACCACGACGCAGACGCAGACGCAGACCGAGAAGATTGTCAAGATTGGGTCGGCACGCAT
GCTGTTCAAGTATCTGAATCCGCTGCTGTCGGCCACGTCGACGTCGGTGCGCGAGTCGGTGGTGGCGGGCATGGCTTCGA
TCAATGCACATAGCTACCGGACGCTGCTGCAGGAGCTTCAGGGTCATGTGTCGCGCTGCAACGACGAGGCGCGGGCACGC
ATTCACCAGCGGACGCACAGTGGCCCCAAGCGTAACCGCAAGATGGATCTGCTGCGCACAGAGATCACGCACGTGTACCG
GCTGACGGCACACTTTTTGCAGGAGCCGTTTGTGTACGGCGACGACTGGGTGTTGGGTAACCTGGTGACGTACACGCGCG
ACATCAAGCTTTTTCTCAACGACGGCGCCGTCCAGCTGGACATGGAGTTTCAACGTCTGCGCCGCCATTACTGTGGCCTG
ATGGAGGAGCTGTACCGGGGCATCAGCCGGTCACGTGATCCGTCGCGCTGGATGACGTTTGAGGCGCGCAAGTCGGCCTT
TTCGCTGATGGAGGACTGGTGCGGCTTCTCGCCGCAAGTAGGCGGAAATGGCGGAAACAACAATGCGCGCAGCCGTATGG
CCCTCTCGGCCGAGCCCGAGCGCAGCACACGGACGGCGGCGATGGAGATTGAGAAGCGCCACCTGCGGACGGCCGCGCTG
AGCGCCATGGCCGCGCTGTGTGGCGGACCGATCGGCGTGACGCTCGCCAGCGGAGCGACGCTGCAGTTTGACGTGCGGCG
CATGTTTGCCTGGATCGAAGGCATCTTTGCGTCAGGCAATGACCGGATGCGCGCTATCGGCCGCACGGCTCTGCAGAACC
TGATCGTGCACAACAAGGAGCACGCCTTTCTGCTGGAACACAGCATCGGACGCTGCTATGCGACCGAGCTGCCACGCGTT
CTCGAGAGCTACTTTGAAGTCGTGACCCAGGTCCTGCTCGACCACGCCGACTACCCGACGCCGTTCTGGCGCCTGCTCGG
CCTCTGTCTCTTCATGCTGGGCAACGAGCAGAGCGAGGTGCGGTCGCGGTCGGTTCTGTTGCTGCGGGCGCTAGACGTGC
GGCATCGCCAGCGAGAGAGGGAGAAAGCCCAGAACCAGAGCCAGAGCCAAAGCCAGAGCCAGAGCCAGAGCCAGAACCAG
AACCAGAACCAGAACCAGCTGCAGCTGAACCAGCTTGGTCAGACGCTTAGTCAGCAAACACAAGCTCCAGCTAAGCTGCA
GGACTTTGACATCAGCGTGGCCGACAAGACCAAGGCGGTCTACAAATTAGCCCAGTACAAGATCTCGGAGCGCGTGTCCA
AGCAGCACACGGACCTGGCCTTTTACATCTTCTCCGAGTTCACGGCCTACTTCAAGGAGCTGCAGCCGGCCGCCCAGCGC
AACGTCGTGGCCGTCATCCTGCCGTGGGTGCAGGCAGTCGAGCTCAAGGTCGAGCCGGGCGGTGGCCCGACAGCCGAGTC
GTACGTGCTTCTGGCCAACCTGCTGGAGATGACAATCAAGAGCAGCGGCGCGCTGCACAACGAGATCCAGGCCCTGTGGC
AGGCCCTGGCCACGGGACCACACCCGGGCAACGTGCGGCTGATTCTCGACTTTATCATAGCCCTCTGTCTAGAGCGTCGC
GAGCAGAGCTTTGTCGAGTACGCGAAGCAGGTGGTGGTCTTTCTGGCCAGCACCAGCAGCAAGGTGGTCGACTTTCTGCT
GATGCAGATCACGCCTACCGCCATGGTGCCGAGCGAGAATAGCAGTGAGGCGGCCAGGCCGGGGGACGGGACGACGACGA
CGACGGCGACGACGATAACGACGATAACGACGATGACGACAACGTCGGTGCCACCCCTCGCGCAACAGATGTTCCCCTAC
TGCGCGGACCTGAACGAGGCGCTGCCGGTCGGCACGAAGCAGGCGGGCTTCTCGCTCGGACAGCTGTCACTGATCCTGCT
GGTTGACTTGATGGTGTCACCAGTGCGGCTGGCGGCCGACCAGGTGCCGGTGCTGCTGCAGGTCGTCACGGTGCTGTGGG
ACCACTACACGCCGTTAGTGCAGGAGCAGGCGCGCGAGATGCTCGTGCACCTAGTGCACGAGCTGGTCATCTCGGGCATC
GACGACAAGGAGACGAGCGCGGCCGACGGCGACGAGAGCGGGGCGGCCACAGCCTTTGAGGATCTCGTCGAGCGAGTCCG
GCGCCATGACCGGTCTGTCGTGTGGGCCTATGAAGACAGCAACGGCAAAGGCAGCAGCAGCAGCAACGGCGGCAGCGAAG
GAGAGGGCGTGGCCGATGTCGGCACCGAGGTCGGCAGCAGCAAGGTGCCGGCCAGCATGGAGCGGCTGACAGGCGAGATG
GTGCAGACGTTTGAGACGGCCTTTCCCGGGATCAAGGAGCAGTGGGCGCGGCTGTCGCTGACGTGGGCGACGTCGTGTCC
GGTGCGCCATCTGGCCTGCCGGTCCTTCCAGATCTTCCGCTGCATCTTGACGTCGCTGGACCAGTGCATGCTGGCCGAGA
TGCTGGCGCGGCTATCCAACACGATCGCGGATGAGGACGGGGAGATCCGGACGTTTTCGATGGAGATTTTGACGACGCTC
AAGACGCTGATTGTCAAGCTGGACGGCGACCGGCTGCTGGCCTTTCCGCAGCTCTTCTGGACCATGTGCGCCTGTCTGGA
ATCGATCAACGAGGGCGAGTTTGTCGAGGCGGTCGAGATGCTGGACGGCTTTCTGGGCAAGCTGGACCTGCAGTCGGCGG
CCGTGCGCCAGCGACTGCTGGACGGCCAGCCAGCTCGATGGGACGGCGCCTTCGAGGGCCTGCAGCCGCTACTGTACAAG
GGCCTGCGGTCGTCGCGCTGTCTGGACGCGACGCTGCGGGCGCTCGGCCGCGTGGTGCAGCTGCCGAGCGACGCGCTGGT
CGGCGATGACGACCGGCTTTTCCTAGCCCTGGTGGCGAGCCTGCCGCGAATGTTGGAGGAGCAAGAGTCCGAGAGGGGCG
GCGAGTCCGAGAACATGGCGTACACGCGCACGCTGCTGGCTCAGGCGACGGCCCAGGGCCACGGACAGATCGCGGCCGTG
CTGGAGACGTACCTGCAGTCGGCCCACGGCGACGAGACAGAGTTTGCGGCGCAGATGTTTGCGGCCCTGCACGGCGACCA
GTTTTTGCCACGACTCGACTTTGCACTGATCTCGATGTTGATGGGAATGCTGACTAATAGTCGACCCTGGGTTCGGCTCA
AGACGATGCGGCTGCTCTGCGTCTTCATCCCGCGCACCGACATGCGGCAGCCCGAGATTGCTGGCCACGGATCCGATCTG
CTGTCGCCGCTGCTGCGGCTGCTGCCCACCGAATACTGCATGGAGGCGCTGCAGGTGCTGGATAACATCATGACCATGTC
GGGCTCGTCCATGGACAAGCACCACATCCGGATGAGCATGACGCGGTCGACGTCACGGGCCATCCGCAAGCAGTACGAGC
GCACACAGAGCCTGTTTGGCATCCCGGAGGAATCGGGCTGGGCCATCCCAATGCCAGCCCGCAAGACCGACGCCACGCGC
GCCAACATCCGCCGCGTCTTTTACAGCTGTGGAGAGCTGAGCGGTGGGACTGGCGACGGCAGAAACGGCAGCAGAAACGA
CAGCAGCAGCAACATCAACAACAACAACGACAACAACAACAACAAGCCGATCCTCGGCGACCAGCCAACCGATTCCACGC
CGCCGGTCGAGTTCCACGCCGAGGACTATGGCTTTGCGTCGATGGAGCGCAACGACGCGATGCTGTCGGACGAGACAGGC
CTTCGCAGCGACGGGGTGGGCAGAAACATGCATATCCACATGAGTGCTGCCGGAGGTGACCTGGTGACGAAGCTAGACAG
TCTGGACGACTTCTTCGACGACGACAACAGTGGCGGGCGGCTTCTGATGGTTGGCGGCAGCGGTGCTTCGGGCGCGCAGC
TGTACGACGAGATCGTGCCGTTGCTGCACCAGGCATCGGCCAATCCGGCCATGACGACTCATCTGCACAACCAGGCCTTT
GCCGATCGGCCGCCCGGATCGCGAGATGGTGGCAGCATGGCGACGAGCACGCCCAACAGCGTCGGTGCCAACATGATGAC
GCCGGCTGCCTTCAGTCCCGGCTCGACGCTGCGTCTTAGCCCCGGCTCGACCGGCTCAAGCATGACACGACCAGCTTTGC
ACATGCGCTCGGTCACATCGCCATCGGCGCCTTCGGCTGCTGCTGCGTACATGCGCGACCTTGTGTCGGACGACGAGCCC
GACGAGGTTGTCTTTTCGGACGGCGAGGACGACCGGTCGTGGGTCGGCAGTCTGGGCGGGGGTCCGGGGCGAGGACTGGC
CGGAAACAGCGCCTTGCCGGTCAGCATTGTGGCCAGCAACACGACCACCCCCAGCGAGGGTTCTTTCTTCTTCGAGACCA
TGATTCGGCCGCTGGCCCAGAGCACTCGGTCGCGCATGCGAAGACTGACGGGCAGCCGGTCGCGCGATGAGCGAGCCGCC
ATCGATCTTGGATTGGGCGGCGGCAACAATGCGAACACCAACATGAACACGGCCTCTGTCCCCATGGGCGTCACCAGCAG
CGCGCCCGGTGCTCCCGGCGTGCCGGCGCTGCCAGCAATGCCTAGCATGGGCAGCTTGCCGGGGACGCCACAGCCCAAGG
TGCCGAATGCGTATCTGACAAAGGGGCCGTCGAGCGATATGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62