GenePrediction:GLEAN_5122 Details

Name: GLEAN_5122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1683577..1681757 (- strand)
Length: 1821
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1683577..1683228 (- strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_97:1683158..1682991 (- strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_97:1682919..1682521 (- strand)
Length: 399
Type: CDS
Source: GLEAN
Position: GCSC_97:1682453..1681757 (- strand)
Length: 697
>GLEAN_5122 class=GenePrediction position=GCSC_97:1683577..1681757 (- strand)
ATGACCAGAGGATTAGGAAAGATGTCGTTTGACAAAGACAACTCGACAACGGACCCGTTCGCCGGTGATGCGGAGAAGCA
GATGCCCAAAGAAAACTCCCACCCAGTTGAAGAAGCCAGCACACAGCGTTGTCGTGGCCGTTTCGGTGGCGTGTTGGGAA
GTTTGTTGACTGTCGAGAAGGGTGACTTGTCTGATCCGGGAAAGGAACACAACCTGAAATGGTACCAGCGGCTACTGGCT
GCTGGCATGGAGACGAATGGCATTGAGCCGGTACCCGTCGCCAACCGGACGAACAACCAGCACTGGAATCTGTTCACTCT
CTTCTTCACCAGCATGCTCTCTCTTCTGCCGTGAGAACCCTTTTTCGATCCCAAAGTCGAGGCGCTTCGTGGTCGTCGAG
CCGAGCTAACAGAAACCAGTCTCCCGACAGGTATGCTGGCCACCTTGAGCTATGGCCTCAGCCTGCGTGACGCCTCTCTC
GTCATCCTCTTCTTCGGCCTATTGACTTCCATTCCGCCCGCTTTCCTGGGTATTGGCGGAACCCAAACCGGCATGCGCCA
ACAGATCCAGGCTCGGTACTCGTTCGGGTATGTGAATCTCCCCTCGTCGTGATAACGAGAGACGTAACCGGCAGCAGACT
GACTAAAAGTGTGAACAGATTATACCCCGCTGTTGTCCCTCTTATTCTGAATGCCGCGACGATCACCGGCTTCACCCTCA
TCTCCGCCGTGGTCGGTGGGCAGACCATCTCGGCCCTCAATCCGGATCATGTGAGCGTCAAGGTCGGCATCGTCATCATC
TGTCTCGTGAGCTTCTCCGCGGCCCTTCTTGGCTACCGCGCATTGCACTGGCTGGAGACCTGGTCGTGGATTCCCAACCT
CATTTCCCTAGTAGTTGCTGTGGGTTGTGGTGGTAAGTACCTGCACCTGCAGTCCGACACCCTACCTGCGACGGCTTCCC
AGGTCCTGTCCTATGGTAGTATCGTCGCAGGCTATTTCCTGACATTTAGCGGTACCACTTCCGACTATTCCACATACCAC
AACCCAAATGTGTCCAAGTAAGTCTCTGGCCTTGCCGTACCTCCCTATGTAATTAGTAGGCAACAGGTGCTGACAACGGC
CCAGGACCAAACTCTTCTGCTATATGTATTTCGGCATATTGTTACCGTCTATACCACTGCTCGTCCTGGGTGCCGCAATT
GGTGGTGCTGTTCCAAACGTGCCTTCGTGGAGCGTTGCAAACGATAGAAGCAGTGTGGGGGGTGTCCTATATGAGATGTT
GCGTCCAGCCCACGGCTTTGGGAAATTTCTCGTCGTGTTGCTTGCCCTCAGCAGCATCGGAAACATCGCCATATCGTCAT
ACTCAATGGCACTGAATATGCAGATGATGCTTCCCATTTTCTCCCGCGTTCATCGCTTTATCTTCATCCTCATCGCGATG
GCTATTGTCATCCCCTGTGCGATCAAAGCTGCCCAAGCGTGGGAGGAGAGCCTCGAAAACTTCCTGGCCATTATTGGCTA
TTGGGCAGGCTGCTTTTCCGTCGTGCTGATCGAAGAGCTGACAATCTTCCGTCGCATGGACTTTTCGTCTTATGACATAA
CCATTTGGAATGTTGGCAGCAAGTTACCGACTGGCATACCCGCTATTGTTGCGTCGATTCTCTCATTCGGTCTTGTTGTC
CCAGGCATGGATGAAGTTTGGTACACTGGTCCAATCGCTAAGAAATCCGGAGACATCGGGTTTGAGATGGCTTTCGCCAT
CACTGGAGTGTTCTACCTCCCTCTTCGCTGGGTTGAAATCAAATGGCGGGGTCGCCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62