GenePrediction:GLEAN_5123 Details

Name: GLEAN_5123
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1675839..1672005 (- strand)
Length: 3835
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1675839..1675655 (- strand)
Length: 185
Type: CDS
Source: GLEAN
Position: GCSC_97:1675578..1672005 (- strand)
Length: 3574
>GLEAN_5123 class=GenePrediction position=GCSC_97:1675839..1672005 (- strand)
ATGTCCTCGACTACGAGCAGCACTGCTGCTGCCACTTCGAGCAGCAGTTCGGAAAGCGGATCGGCCCAGAGCTCGGCTGG
CCTTAGCGTCGTTGCCTTCTTCACAGCGTTGTCGACTTCGTTGGTTATTTTTGCCGTCCAGTTGGGCGTCTTCCTACTCC
TCAGAAACAAACTGGCCCGCATTTTGTCAGTATCCTACCGCTCTCGTGAGCCTCGGAAGAAATGCACTGCAGATCTGCTA
ACCGAGTCTCCATTCCAACAGCAAGCCCAAATCTTTTCTTGTTCCTGAGCGCGAGCGAACAGACCCTCCCCCAGCTAGGC
CTTGGACTCTGGTGGCAGCGCTCCTGCGCTTCGACGATCGCGAGATAATCAAAAAGAGTGGGCTCGACGCCTTCTTCTTT
CTACGTTACCTGCAGACACTGTTATTTATATTTGTCCCCATCGCCCTCATTGTCATCCCTATCCTCGTCCCCATCAACTA
CGTTGGCGGCCTAGGCCAATCGTTCACTGCAATCGATGCAGCAGCCAACTCCTCGGTTCCCACCGGCCTGGATACCATTG
CGTGGGGCAATGTGAAGCCTGTCAACTACAAACGCCATTGGGCACATCTGATTTTGGCTGTGCTTGTCATCCTCTGGGTC
TGCTTTATATTCTTCTGCGAGATGCGTGTTTACATCAAGGTTCGCCAGGACTACCTCACCAGTGCGGAGCACCGCCTGCG
TGCATCGGCCAATACAGTCTTGGTCTCTGGCATCCCTGAAAAGTGGCTTACCGAAGCGGCCCTTCGCGGCTTGTTTGACG
TTTTCCCCGGTGGTATTAGAAATATCTGGTTGACACGGGACTACACCAAACTGCTGGACAAGGTCCACGAACGCGAAAAC
ATTCACGAACTGCTCGAGGCTGCTGAGAGTGAGCTCATCCGCAACGCCAAGAAGAGCCAGCTTAAGAAGCGTGCTGCCGA
CGAGAAAAAGGAACGCAAGAAGTTCAAGGCAGGACACGCCTCCAAAGCCGATCGCGAGGAACGTCTGCGGCATGAAGACG
AGGAGGCTCAGCGGATGGCACAAGGCGAAGGTGGCATGAGCGTTGGGCATCGTGCCGTGCCTCAAATCGACGGGATAGAT
GATGCCAGCACCCGCAAAAGCAGCACCGAGGCTGCAAGTCAACCGATGCAGCGCCAAAAATCAATACTCAACCGGGTTTC
CGGATTCGGCCTAGGTTTCTCCAAGGTTGGCTATGGCATCAGCCACGGCATTGTGGGCGGCGCTAAGACGCTGCAGCAGG
GTGTCGACAGCCAGCTCGAACGGACGGGAGGCTTTGATTTTGTTAAGACTGCCAATCAGCAGGTGCCCGGCCCATCGTTG
CGTCCTACCACGCGAGACTCGGATCATCCTCGCGTTGGTGTCCGGATCATGGACAGCCCAGAGAGCTCGCCTCCGTTACA
AGAGACCAGAACGGGCCATCATTCAAAGCCGTCGGACGTCTCTTCACTGATCAGCCGGCCCAACGAGTCGACAGCGCAGG
GTAACACTACGCGCAAAGTCACAAACTGGGAGGATGCCATCGCCATTGAGAACAGCAAATGGTGGCAGTTCTGGAAGCCG
CCCAGCGGTGCCTATGCCTCGCCTATTCCGCAAGGATATGAGGCAGATGAGTTTCTTCTAGACGGGGCCGAGACGGAGAA
AGAAGGCAAAGCCAAGTCTATCTGGACCCAGATTTGCACAAACATGCCCTTCTTCCGCAGTGAGGACGATGACAATGACT
ATCCGGTAGCCGAAAACGCAGACTACCCGGGCGATGAGAAGGAGGACGAATTTGCCGAGTGGAGAAAGTGGCTTCAGCCC
TCGGATCGTCCGACGTGCCGCCTGCCCATTTTCAGCTGGACTCCGAACTGGCTGCCTGGCCTGCCTCTGATCAACAAGAA
GGTCGACACCATCTACTACTGCCGCAAGGAGCTTGCCCGGCTGAACATGGAAATCGAAGAAGACCAGCAGGACCGGAACC
ACAAACGGTACCCGATCATGAAGTCGGCCTTCATTCAATTTAACAACCAGGTCGCGGCCCACATGGCCTGCCAGAGCATC
ACGCACCATGTGCCCATGCAGATGGCGCCCCGCGTCGTTGAGATCTCGCCCGACGATGTCATCTGGGACAACATGGCCAT
ACGCTGGTGGGACCAATGGCTGCGCACGTTTATTGTCATTAGCGTCGTCTTTGGCATGACCATCTTGTGGGCGTTCCCTG
TGGCGTTCTCCTCGTCCCTGTCCCAGATCGACTCGCTCGTCGCAAAGTACCCGTGGCTGGGTTTTATTGAGGACAATCCG
GTGACGTACGACGTGGCTAAGGCTGTTGCCGGCGTGCTCCCCGCTTTGATCCTCTCCATTCTTCTGGCGCTGGTGCCCGT
CATCCTCGACCTTCTCTCCAGTTTCCAGGGCGCCAAGACCGGGTCGCAGAAAGCAGAATATGTGCAGATATACTACTTCT
TCTTCCTCTTCGTCCAGGTTTTTCTCGTCGTTTCCATCGCTAGCGGCGCCGTTGCCACTCTGCAAGATACGGTGACAAAT
GTGCAAGGCATCCCCCAGATTCTGGCCAAGAACCTGCCAAAGGCCGCGAACTACTTTTTCAGCTACATGATTCTCCAAGC
GATGTCGACCAGTTCGGGTACACTCCTACAGGTCAAGGTCCTGCTGGTGTGGTACATCCTGGCTCGCTTGGTTGACGACA
CTGCTCGCAGCAAGTGGAGGCGCCAGACGGAACTTCCAAACATCAGCTGGGGCTCCTTCTTCCCTGTGTACACCAACTTT
GCTTGCATTGCGCTTGTGTACTCCATTATCGCTCCCCTGATCTCGATATTTGCTATCATCACGTTTGCGCTGCTCTGGTT
TGCCCATCGCTACAACATGATCTACGTCAATCGCTTCAAGATCGACACTGGCGGCGTGCTTTATCCGCGGGCCATCAACC
AGACGTTTACCGGCCTCTATTTCATGGAGCTCTGTCTGATTGGCCTCTTCTTTCTCGTCCGCGATGAAAACGACGACACT
GTTTGCGTGCCGCAAGCCAGTATCATGATCGTGGCGTTGATTCTCACGGCGCTCTACCAGATCCTGCTCAACTGGTCTTT
CGGGCCACTTTTGCGGTACCTGCCCATCACATTCGAGGACGAGGCTGTTCTCCGTGACGAGGTCTTCCAGCGGGCACTGG
ACCGACGCATGGGCCTCGTCGGCGATGACGTCGGATCGGACGACGAAGCGGCAACGCTCACAGCGGCCGACAGCCAAGTC
ACTGGGGTTGCGAGCACCATTCCTAGCGGCAACGGTGATGGCGTGGAGCTGAAGACCCTGAAAGGACGAGGCCACCAAAA
CTCCTTTGGACTTTCGAACCGCCTGAATCCTGTCCGCGGTATTGCTCAGGCAGGCGCCTGGGCGGCTCAGGGAGGCAAAA
AGGTACGATACGCTACACTTGGCAAAGCAGAGCATAATTTGCAATTGGCGTCCAAGTTTCGTCAAGAGCGTCGCCAGAAA
GATCTGGAGGCCCAGAGGGCTATGGGGGAGGCTCTTTATGGAGGGTACAACGACGAGATTGAAGACCTGACGCCCGAGGA
GCGCGACGCTCTCGTTCGAGAGGCTTTCAAACACTCGGCTCTGCGGGCGCGTCGTCCGACTGTCTGGCTTCCTCGGGATG
ACATTGGAGTCAGTGACGACGAGATCCGACATGCATGCAACTTGAGCGACTACATCTGGATCAGCAACGAGGGAACAGCA
TTGGATAGCAAGGTTCGCGTGGTCTACGGCCGTGCGCCGCCAGACTTCTCGGACATTGAGCTGATCAACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62