GenePrediction:GLEAN_5124 Details

Name: GLEAN_5124
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1671532..1670695 (- strand)
Length: 838
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1671532..1671447 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:1671343..1670695 (- strand)
Length: 649
>GLEAN_5124 class=GenePrediction position=GCSC_97:1671532..1670695 (- strand)
ATGGCAGCAAATGCAGCATCGGCGGCGAAGGGGGTGGCGGCCACGGCAGGGTCCAATTTCCGGGTGGGCGGGGCTAAAGT
GTTTCTGTGAGTTGAGCGCGGGACGAAAGCAAGACGGAGCAGAAGGCGACGAGGGAGAAGGACGATACGATGGCAGGATG
CAGATGCACGACAATTCTGACGCTGGCAGTCCCGGACACGTGATCAAGATGCTACCACCGCGACGGATCGTGTCGCCGTA
CTTTGCAACGTTCCAGGTGCCGCTGCGGTTCAACAAGCTCGACCTGCGCGACTACCTGTACCACGCCTACGGCGTGGAGG
TGCGCAACGTGCGATCGTGGCTGACGCCGCAGCTGCCGCGACGGCGTTTCAGCGACGGTGGCAGCACGCCGCTCGGTGGT
GCCGACGACTTGGACCTGCGCGACGCCAAGTCCTTTGGCCGTGGGCCGTGGTACCGGCCGCAGCCGATCAAGCGGATGAT
GGTAGAGCTGGTCAAGCCGTTTGCCTATCCAGAGGCGCCGGCCGAGCCGACCGAGGCTCAGCGCGGCACCGACGACGATC
CGCGCGCTGGCTGGGACTACGACATGCACCGCCGCCTCGCCCTGCAGCAAAAGTCCCAGGAACAGAGCCACAGCCTGCGC
GTGCACGAGAAGGAGTTTCCTCTGCGCGACCAGGAAGAGCACGTGCCCGCCTTCCGGGTCGGCCTGGCCAAGCAGGCCCG
CGAGCTCGTGCTCGGCGAGCGCGCCTGGCGCAGCTCCGCCAAGCTGGACGCCCGCTGGGACGCACTCGAGGCGGCCGAAA
CGAAGAGCGGTGCCGGCGGCCCGGCCAGGTCGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62