GenePrediction:GLEAN_5125 Details

Name: GLEAN_5125
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1670137..1667599 (- strand)
Length: 2539
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1670137..1669714 (- strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_97:1669626..1668883 (- strand)
Length: 744
Type: CDS
Source: GLEAN
Position: GCSC_97:1668587..1667599 (- strand)
Length: 989
>GLEAN_5125 class=GenePrediction position=GCSC_97:1670137..1667599 (- strand)
ATGTCCGGACACTCGCCTCGAGGCGAGATGGACGCAGACAAGCAGCCATGTCCGCTACATATCGTCAAGAGAGACAGCGA
TGCATCCTGTTCCAGCAGCAAGAACAGCCGTCCCGGCCAGCGGAAGTCCAGCAGTGGCACGGACGAGAGCCAGGGGAGCG
TTCGCGAGGTGACCGGCATGGATCTGCCTCTGGCAATTCCGAAGAAACGAAAGGGCCTGATGTTCCGTCATGGCGAGCGC
TTCAATTCCGGCGCTTCGGTCGCGAGTCACAGAAGAGCCCTGAACTATACCGACAACTTCGAGGACCGTGATGACAGCAG
CAGCGACAGTGGCGAGGAGGGCAGAAGACTGATTCACACAGCTGAAGCTGACGGCTTTACCTCTGTGCGACTGCGATATT
TGCAGGACGAGCAGAGCTCCGAGCGTAAGTTTTTCTTTTTTGACAAACTAGCAATGGCCGAGGAATATGGCCAGGAGAGA
GTGTAAGAGCTGACTCCGGATGTGATAGCAGATGGCCATAGAGAAAGGCTAACATCTCAACCACCACGGCCGATCCCTGA
ACGGGTCCCTTCTCCCTACTTCAATTTGGTAGACACCATGCACTCGAGGAGAGCTGAATCTGAAGCCGAAGCTGGAAAAG
AAGCCGAAAATGATAGCTATCTCCATCAGATGGACATCATGAGACACGGCCCTCCGCAGACGGAGGAATTTGGTCTCTGT
GATGACGAGAATCGATCCAGACGTGGCATTGAAACTAGAGACGACATGCTCCGCCGGTGTCCGTCATATGAGTATATGCC
GCGAACAGGCTTATCCCCTACCCCTACATCTCACACATATGGAAGGCTAGCATCGACAAACACATTGCCAGAAGTTGAGA
CAGTTCCTCTTGGTCCATTGGAACGATCGGCAACAACTTTCCCCTTTAGAAGCCAACAGCATCATCAGCACCATCAGCAG
CAATACTACCAACATCAACCTCACAACCCTCAGGCTCAACCACACTTTCGGCCGAGCTTGCCCTACTTACTTTCAGAGCC
CGTTCCGGACCCGGATCCCCAGATGCTCACGCCCGTCATTACAGTCACGCCTGAGCGCAGATCTGTGGGTGGGACTGTGA
ACCGCTTTTGGGTCGCAGTTGAGCTGCATGCACAAATCACGCGGCCGTTAGATGGGGGGTTTTCACGTGATTACCCCTTC
CACCACAGCAGCCGGCAGTCCTCGATAAGTGTATCTTCTTTCAAGAACAACGCGGGTATGTATATATTGCATATTTCGCA
TGTTGAACTGCGGAACATACCTACTGAACGAAATGGATTGTAGGCCTCTATCGATACGGATATATATCCGATATGAATAT
CGAGGTTCTTCCGACTGCCAAAAGTGAGATTCTAGAAGTCATAGGGAAGAGTCCCAGCCTTATGTTAGTAGGACCACGAT
ATGAACACCTTGTGTGCCCTAGTGGCTTTATTGCTAACCAATCTATAGAACACTGCTTCCTGGATCTCGGCGTCTTCTTG
TGGCCCACGTCCAACTTGACACCAAAAAAGGCACGCCCCAGATGCCGGCTAATGATTACTGGGCCCATCGTCAACGGCAG
AATTCCGACAGGCTCATTGAAGACTTGGAAGTGCAACTAGGAGCAACATCTCAAGAATATATGCACATCCGACTCACGTA
CACGCACTCTGGCTTTCCAAAACGGGAGATTGGGCGAGATGTGCTGGGACGGGATGGCGGATGCGTCTCGGTGCGGACGA
CGATTGAAACCACGGCCACAGCTGTGATCATGCAGCAGAACGCCTGCTCGCCCTGGTCGCCTCCGCCACCGCCGTCGAGC
AGTCCGCTTTCGGGAATTGTGGCCAGACACTGGGGGCCAGCCGCGGCCGCGGACATGGCGCAAAGAATGGCAGCCACGTC
AATGGTACGGATGGCGAGGAAGTCGGCAAATCCAATGCGGCCGTGGGATTCGTTCGATCCGCACTTTTCAGCAGAGCGGC
AGAGGACACCGGAGATGGCAGATTCCGGCGAGCAGGAAGAGGTTACGCCCCGAGCAGCATTGCAACAGCGCGAATCGGGG
CCCAAAGACGACGAGTCTTCTCCCAGACGGGCACCGACACCTGTAGGCAAGATCTGGAGACAGATTCGACGGGTATCGTC
CACGGGGATGCGATCGACGTCCCGCCAACATGCCCAAATGTCGCAAGACGAACTCAGGTCATCGTCTTTAGCCAAGCTGC
GGGTAGGGGAAGACTCACCGCTGCCGGGCTGCTTTCCGCCACGGACCAAAAATGCCAAAGAGCCGGCAGAAGGGCTGAGG
CAGGCAATTCCCGACACGGCACCTCGCGCGATCAGGCGTCCAGTCGGGATTGACACGACGAATCTGCAGAGCCTCAGCCA
CCGGGTGTCGGACATGAGCCTTGGCAGCGAGAATATCAGAGAGAGGCAGCCGACATACAGCGGGATGCGAAGCAGCAGCC
GCAGCAGCAGTATGAGTAAGAAGTCGGGAAAGTGGTCGTGGACAGGATGGTTTGCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62