GenePrediction:GLEAN_5126 Details

Name: GLEAN_5126
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1665833..1663298 (- strand)
Length: 2536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1665833..1664571 (- strand)
Length: 1263
Type: CDS
Source: GLEAN
Position: GCSC_97:1664495..1664031 (- strand)
Length: 465
Type: CDS
Source: GLEAN
Position: GCSC_97:1663978..1663298 (- strand)
Length: 681
>GLEAN_5126 class=GenePrediction position=GCSC_97:1665833..1663298 (- strand)
ATGTCTGGCCGCAACAGGAAACGAGCCCGCGCAGACGAGGACGCCGAGATGGCCGACGATGCGGCGCCGATGGCGGCCGG
CTCGCCTTTTGCCAAGAAGCGACTGCGGCTGGCGAGCGCTGCGGCGGCGCTCACAGCAGCACCGACGACGCCCCAGACGC
CGCGGACGGTACATACGATAGCGTCGGCGATCACAGGCGCGCTCGCGTACGGGGCAAACCAGGTGAGGCGGACGGAGTGC
GAGCTGGACGGGACAAGAAGAGAAAAGGGCGAGGCGTACGATGCGTACGACGAGTACGATGTCGACCAAAACAAAGACAC
GCTCGTCGATTCGGCCGTCGGTTCGACCACGCCGTCGCGGCGGAAGAAACGCGACCCTCTCGGCAACCTGGCCATCGACG
GGACCGACCGGCTGAAGAGCGGCCTTGACCTGGGTCTGTCGCGGAGCCAACGGGTGCGCAACACGCTTAAGAAGTTTGAA
GAACGTGTACAGGGCGGCGGTGGTGGTAGGAGTCGGGCACGAGATCGGACGAGCGGCACCGCAACGGCAGCGACAAGACC
AAAGTCACCGGTCAAGGCCCGGACCGTTCTGCGTGGGAAGCCGGAGTCGGTAAAGGAGGGACAGGAAAAGATGCAGAGAG
ACCAAAACGACAACGACGACGACGACGACGACGAGGTGTGTGCCATCTGCGGCAAGCCCGAGTCGGAACCGCCCAACGAG
ATCCTCTTCTGCGACCGCTGCGACCTGGCCGTCCACCAGCAGTGCTACGACGTGCCGGTCATCCCGGTGGGTGACTGGCT
GTGCAAGACGTGTACGTCCGGAGGCGTGGCCGAGGGAGTGGCCGAGAGCGGCGTGCCGTTGCAGCCCAAGGCAGAGTTTG
CACAGCAGAAACCACCATCACAGACCATTGCCCACTTTGAGCAGCATCTGCAGGGGCTGCAGCGCGTGCTGCTAGACCGC
TGCACCGGCCGCCGACGGCTGCGGCTGCGCGGCCAGGACGAGGCCTGCGACAAGGTGCGCCAGCTGGTCGAGCAGACAGT
GGTGGCGGGCGAGGGCAACTCGATGCTCGTCATCGGGGCTCGCGGCATCGGCAAGACAGCCCTGGTCGAGACGGTGCTAG
ACCGCATGGCGACCGAACATGGCGACGCCTTTCACGTCGTGCGCCTCAGCGGCTTCGTCCACACGGACGACCGGCTGGCG
CTGCGAGAGATCTGGCGCCAGCTGGGCCGAGAGATGGCCGTGGAAGATGAGGTCGTGAGCAAGGTGAGTTTGGGGGCTCT
CTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTCCTCTTTTCTTTCTAACAAACACCCAGACCACCAGCCATGCTGACACGC
TAGCATCGCTACTCGCCCTGCTCTCGCACCCGTCCGAGATGGGCGAGGCTGTGACCACCGACAGCAGCTCGGCCGACCCC
AATAGCGCAGTCACTTCACGTTCTGTCATCTTCGTCATGGACGAGTTCGACCTCTTCGCGACGCACCCGCGGCAGACGCT
GCTCTACAACCTCTTTGACATTGCCCAGGCTCGCAAGGCGCCCATCGCCGTGCTCGGCCTGACCACCAAGATCGACGTCG
TCGAGAGCCTGGAGAAGCGGGTCAAGAGCCGGTTCAGCCACCGGTACGTCTACCTGTCGCTGCCGCGCAGCCTGCCCGAC
TACTGGGACGTCTGTCGCCAGGGGCTCGTCGTCGACGACGAGGACGACGCCCGGCGCGAGCACATGGACACCGCCCTGGC
CGGCTTCTCCGCCTTCCAGCAGTGGTGGAACCAGATGATCGAGGTGGGTGTTGCTGTTCTCTGGTCACGTGTGCTTACAT
ATGCTTACGTAATAGAATCGGCGCCGTGAGCCGGCTCTACAGAGCCAGCTCGAGTTCCACTACCACAGCAGCAAATCGGT
GCCGGCCTTCTGGACAGCCTGCATCATGCCGCTGGCAGCGGTGTCGGCAGCGGCGCCGCGCCTGCAGATGCCGGCCGTCG
GCAGCGACAGCACAACCCCGATCGGCTCGCTGGAGGCGCCCGACTCGAAGCTGCAGCTGCTGGCATCGCTGTCAGAGCTG
GAGCTGGCGCTGCTGATCGCGGCCGCCCGTCTAGATATTGTGCTCAGCACGGACACGGTCAACTTTGCCATGGCGTACGA
CGAGTATGTCTCGCTGATGGGCAAGCAGCGCGTGCAGTCGTCGCTGGCGTCGTCGGCTCCGGCCATTGGGGCTGCCGTGG
CCGCCGCGACCCGACGAACACCCGGACGTCCGGCCGGTTCCAGTTCCGGTTCTGGCATCGTCGTCGGCGGTGGCGCGCGC
GTGTGGGGTCGCGGTGTGGCAGCACGGGCATGGGAGCGGCTGGCCTCGCTGGGACTGCTGCTCCCGGCCGGTCTCGGCGG
TGCTGGTGGTGCTGGAGCGACGGGTGGGCTGGAAGGACGGAGCATGTGGCGGGCCGAGGTGGCACTCGAGGAAATCCCGG
CAGCAAAGGGCATCCGGCTGGGCACGATGCTGTCTCGATGGTGCAAGGAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62