GenePrediction:GLEAN_5128 Details

Name: GLEAN_5128
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1648718..1647401 (- strand)
Length: 1318
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1648718..1648698 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_97:1648394..1648281 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:1648180..1647401 (- strand)
Length: 780
>GLEAN_5128 class=GenePrediction position=GCSC_97:1648718..1647401 (- strand)
ATGCCGACTGAGTTGGAGGAGGTGAGCTCAACAGAGGCTATATAAGACGGCCTAGAACACTTATTTCCCCTTTTGATGCG
ATGGAGTTCACAAGAGGTTAACATACGGTATAGCTGGTCGGCTTCATTGTCCATCCAAACCCGCAGATAAGACTGCTGGC
CACTGAGAATCTAGTGCCATACTCGAATTCACAGCCCTCGATATTCAAAACAGACAATTCACTCCCTTTGAAAAATCTCA
AACTCCTTGTTGCAGACCACCCTGTAAGATTCTATGTCCAGTACTTTTCATTGCCACCAGACAGACAGCTAACGCTATTT
CCAGAAAATCGCTGAACATGTCATCACAATACTCATCAACCTGTCTGGTGATCCGGAAGTATTGAATAACTTGGCCTCGG
ACCAGAAGTTTCTTGACCTCATCTTTGCCTGTGTGACGGTACGTACGCCTTTATATCGCCTTTATACGTAAGGGCAGGGA
AAATAAATTTAGCCTGGAGCAAGATATCATGACTAGTTCTGACAGTGTGGTACCCCAGAATGAAGCCGAGCCCAATGCAA
ACTTGATGGCCATGCTACTGGCCAACTTGGCCAAGTCAGATGATCTGAAAGGGATATTGGAGCGAACACAAAAGCCATCA
GAGAAGCTCAGCTCAGATGATCGTGTTATTAACCAGCTTATGGATCTCTTTGTGAAAGGCTTTGACGGATCATTCAACAA
GAATGCGGATTACGACTATCTGGCGTACTTTTTTGCCGACATGGCCAAGCACGCCGAAGTGCGGCAACACCTGGTGACAA
AGCAGCCTTACGACAACGTTGTTCCGATTACCAAGATTACGGTTTTTACGAACCACAAGTCCGATGTCCGGCGCAAAGGT
GTGGCGAGCATGCTTAAGAATGTGGCTTTTGATGTACCCAGCCACCCGGCCTTCCTTTCGGATGACGAGATCAACCTGCT
CCCATACCTGCTGCTACCATTGGCAGGGAATGAGACATACGACGAAGACGAGATGTTGGATATGCTGCCCGACCTCCAGT
TCCTACCGCCCGACAAGCAGCGTGATCCAGACAGCAGCATCCTGCAGACGCATGTCGAGACACTGACGCTCCTCACAACA
ACCCGGGAGGGACGTGATTTGATGCGACGGATCCAGGTTTATCCACTTATCCGCGAGACGCACCTGCGGGTAGACGACGA
GGATTTGCGGGAAGCCTGCGATCGGCTAGTGAACGTGCTTATGAGGGATGAGGCCGATACAGGGGCTGTCCCACTTGCCG
AGGAGGAGGACGAAGATGAGCGGATAGTCGAAGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62