GenePrediction:GLEAN_5129 Details

Name: GLEAN_5129
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1645053..1643154 (- strand)
Length: 1900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1645053..1644706 (- strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_97:1644649..1644471 (- strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_97:1644406..1643939 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_97:1643841..1643154 (- strand)
Length: 688
>GLEAN_5129 class=GenePrediction position=GCSC_97:1645053..1643154 (- strand)
ATGGTCGAGATCGAGCAGAAAACGGGCGGTGGCAACGCTGCCTACCACAACTTCCACAACGACTTTGTGCATATCCAGGA
CCCCAACGAGCGTCGTCGTCTCGCGCTCGCCGAGGTCGACAAGGCGCCCTTTGGCTGGTATCATGTGCGGGCGATTGTGG
TGGCTGGCGTCGGTTTCTTCACCGACTCGTACGACATCTTCTGCGCCTCTCTGCTCACCACGATGCTGGGCATCGTCTAC
TTTCCCGGGAAGGGTGCCATGCCCGTCTCCTCGGACACGGCCATCAAGCTGGCCACGTCCGCTGGCACGGTCATCGGACA
GGTCTCCTTCGGCGTGGCTGCCGACATTGTGAGTCGCGGGAGCCGCAGAACATCCAGAGGGACGGCAGCTGACCAGATGC
ACAGCTCGGTCGCAAGAAGATGTACGGTCTTGAGCTCATCATCATCATCTTCGCCACGCTCGCCCAGGCTCTGACGAGCA
GCTCTGCGTCCATCAATATTGTCGGCGTCATCATCTTCTGGCGTGTAATTATGGGCATTGGTATCGGCGGCGACTACCCG
TTGTCTTCGATCATCACGTCTGAGTATGTGGTCTTTCTTTCTTCTCTTTCTCTCTCTCCTTCTCCCTCTCCCCCACTAAC
TGTTCAGGTTTGCGACGACCAAGTGGCGAGGTGCCATGATGGGTGCCGTGTTTGCCATGCAGGGTCTCGGCCAGCTGACG
GCTGCCTTTGTCATGCTCTTCGTCACGCTCGGCTTCAAGGAGTCGCTGGAGACGTCGACCAAGACGGCCAACTGCACGGG
CGTCTGCGCCGTTGCCGTGGACAAGATGTGGCGCACGCTGATCGGCTTTGGTGCCGTGCCCGGCTGCATCGCGCTGTACT
ACCGCCTGACGATTCCGGAGACGCCTCGCTACACCTTTGACGTTGCGCGCGATGTGGAGAAGGCCGACGACGACGTCAAG
GCCTACATGAGCGGCAAGCGTGAGGGCAACCCCGATGAGATCTCACGCATTGCCGCCCGACAGGCTGCGTCCGAGCAGCT
CGTCGTCAACAAGGCTGGCTGGCGGGACTTCCTGGACCACTACTCGCAGTGGAAGAACGCCAAGACACTTGCTGGGTGAG
TTTTTTTTCTTTGTTTCTTCTCTTCTTTCTTCCCTTCTCTTCTTTCTTCTCTTCTCTCTTCTCTCCTTTCTTCTCCGCCC
TAACACTTCAAGTACTGCCCTCTCGTGGTGCTTCCTGGACATTGCCTACTACGGGCTATCGCTGAACAACGCCACCATCC
TGAGCGTCATCGGCTACTCGACCTCGGGCACGCACAGCACGTACCAGTACCTGTACAACACGGCGGTCGGCAACCTGATC
ATCGTGCTGGCCGGCGCCGTGCCGGGCTACTGGTTCGCCGTGGCGACTATTGACACCGTCGGCCGCAAGCCGCTTCAGTT
TGGCGGCTTCGCCATCCTGACTGTGCTCTTCATCGTCTTCGGCTTCGGCTACAACCATATCTCGTCGCACGGCAAGCTCG
CCATCTACGTGCTGGCCCAGTTCTTCTTCAACTTCGGTCCCAACACGACTACGTTCATCGTGCCCGGCGAGTGCTTCCCG
ACACGCTACCGCTCGACCTCGCATGGCCTCTCGGCCGCGCTGGGCAAGATCGGCTCCATCATCGGCCAGGGCGCCATCGC
GCCGCTGCGTACGCGCCATGCCACGGCCAAGAACAAGAACCCGTGGATGAACCACGTGATGGAGATCTACGCCCTCTTCA
TGCTGCTCGGCTGCTTCTCCACCCTGCTGATTCCCGAGACGAAGCGGAAGACGCTCGAGGAGCTGGCCGGCGAGGACATC
CATGTGGCGCCCTCCGACGGCGGCGTCGTCTCCGAGGTCAAGACCGACTCCGAGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62