GenePrediction:GLEAN_513 Details

Name: GLEAN_513
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:270934..275078 (+ strand)
Length: 4145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:270934..270983 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_97:271438..271522 (+ strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_97:271603..271725 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_97:271822..271872 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_97:271948..272659 (+ strand)
Length: 712
Type: CDS
Source: GLEAN
Position: GCSC_97:272845..274730 (+ strand)
Length: 1886
Type: CDS
Source: GLEAN
Position: GCSC_97:274794..274954 (+ strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_97:275033..275078 (+ strand)
Length: 46
>GLEAN_513 class=GenePrediction position=GCSC_97:270934..275078 (+ strand)
ATGCTCTGCAGCTCTGCAGAGTCACGTCCCGTTACGCTTTGCAGAGCCAAGTACGTGGGAGAATGCCTGGCCAAACCTTC
CGGAGAGGGTCCGTCCAGCTGTCCAAGACCAATCAACTTGCTATACAGCTTCACCCTTTTTGTATCTACTCCTCTTCTCA
TCCACCTCTGCTCTCATCTTCTCCATCCCCCATGTTCTTGATCCTACCGCAAGCCCACATGCCATGCCTTGACACCTTCC
ATCTGCTCTCTTAAACGCAGCGTTTCACCGAAAACACCCGTGGTTGTGTCATCGGCTGACTTGAATGCTTTCTGCATCAG
TCTACCTGATAGGCACCAACCGCAGACGGTCGAGGTCGTTATATCTCCGCCCCCTACTTTTCTCTTATTTTCTTCGGGGT
AAGTCCCCGGGCTTCTCAGGGCAGAGCAGTCCCAACCCCTCATCATGTGAGTGCAACCAGCATATCGCCATGGCACGTTG
TCAGGCACTGACAGGGCAAAACAGGAAATTCGGCAAACAAATACAGAAGCGCCAACTCGAAGTTCCCGAGTATGCGGCAA
GCTTTGTCAATTACAAGGCCTTGAAAAAGGTGAGCATACTGGCCGATCGCCGTCAAAACTACATCTCCTCTGCACAGGCA
GATTGCTGACACGAACTGTCATCATAAAGCTCATCAAGAGGCTATCAGCCACACCCACCCTCAGCGCACAAACCATCCCA
CATCGCTCGGCCACCCCCATAGATTCGCAGGCAGCGTTGCAGGCCAACCGGGCAACATTTTTCTTCCAGCTTGTAAGATG
GACTTCCATTTCCTATACTTCCCGATGCAAGCCATTTCAGCAGCCTGCGTCTACACGCACTGGAATGTCGCTAACCAGGA
CCGGGCAGGAACGAGAGCTCGAGAAAGTCAATGCCTTTTATCTTCAAAAAGAGGCCGAGGTAAGGCTGAATGAATACCGT
GCCGTGCTTTTCCTGCCGCTGTCTTATTTTTCTACCTTTCTAATATGCATCCAGCTCAAAGTTCGCCTCAAAACACTCCT
AGACAAGAAGAAGGTTCTCCGTTCACGGGGTGCAGGCGTCTCTCGGCGCTCTGCCAAGTTTACCACCCTGCAGGAGGGGT
TTCAGCAGTTTGCAAATGATTTAAACAAGCTGCAACAATTTGTGGAAATCAACGGCACTGCATTTTCCAAGATTCTCAAA
AAATGGGATAAAACGTCAAAGTTGAAGACCAAGGAACTCTACCTCTCGCGTGCTGTCGAGGTGCAACCATTTTTTAATGC
CACTGTCATCAGTGAGCTATCCGACCAGGCCACGACCAGTCTACAGGAGCTGGGCGCGTGGGCCGAGGGTGACCACGAAA
TCCGTTTCGATGGGAGGGCCCCCCAGCCCGACCACATCGTCAGCAGCCAGCATCTGCTTGGCACCGACGAGGGTGATGCA
GACACACTTCTGTTGGACACGGTTCTGGCCGGCCACCTCGACTCTTTGCGTGACCTGCTGGGTCGTATGACCACTGCAGC
TGCAGCTGCCCGTGGCCAGAATGACGGCACGGGGAACAGCCTGGACATTGCACTTGCAGAGCGTGTCACACGTACCTTTC
TGGCATCAATCAACGAGGGCTCACAAGAGGCACTGAAGTCCCTGATCGAGACAAGACTTGTCGATGTGCACAGCGAAGAT
GACATCAACGAAACTGCCTCCATCAAGCCACCATATACGGCAACACGTTCGTTCTCAACTTTGGCTTGTCCCAGAATGTA
TCTGTCGCCCGGACCGACGTCTATGGCCGCGTGCCTCTGCATTATGCTAGCATGCACGGCCGTCTTGACATGCTCGATGC
GTTGCTTGCAGGTAAGTGTGGTCCGCCCCTCTGTGTTACGCTATTGATCTTGGTCTCTAACATGGCCACAGCGGGTCCTG
ACGCGATCGACCTCATTGACCATGACAACTTTACGCCTTTGATTCATGCCATCATACACGGTTACCTCGACTGTGTCAGC
CGGCTTCTCGAAAAGTCTGCCCGTCTGGACCCCATCTCCGATACTGACCACGTTCCGCTCAACCTTGCCTGTGAGCATGG
ATCTGACGCCATCGTCGAGCTACTCCTGAAATACGGCGCCCGCATCCTTCCTGATGCAGAGGGCCTCTACCCACAGCACC
TTGTTGCCCGATCCGGTCGTGCGCCAACCCTGCTTCTTCTGCTACAGCAATATGGTGCCAACCTGAACCAGGTGGACAAG
CTCTACGGCTGGACGCCACTGGTGCACGCTGCCAGCGAAGGCAACGTTCCCTGCTTACAGGCACTACTTGAGGCCGGCGT
CGATCCTAACATCGTCGACGAAAAGGATCTGCCTGCTATGTACTACGCCGCATGGGAGGGCAATTTGGAGTGCATGCAAC
TCCTGACAGCCATCAACAGCAGACGAAGCCGCCCCCCGGTCTTTCAAGAAAGCCCATTTGGCTTTCAGCCATCTCCTGGC
GTGCTAGGCTCTCTTGGGAGTGGAAGCAGTGCTCCTATTCCCATGGCATTGGACCCCGACGCTATCCCTGTGCTGGAGCT
GCCACCCCCGATCATCCCACTGCGGCGCTACGGCCACAACTTCCTTGATACGAAAACGGTTGTGCAGATAAGCTTTGACG
ATCAGAATGGCGAACCGCCACTCGTATTCTTCCACGACGGCAAATACCCAGCAGCACGGCTGACGATCTCATCCAAGGTG
GCCGATTTGATTCCCAAAAACATCATGTTGCCCTTCCAGGAGGACACACGGCTTGTGTCCTTCCAGGTTGACAACCTCGA
CTCTTTTGTCCTAGACTTTGAAGTGTTTCCCACGTACGGGGCCAAGATCATCGCAAAAACGGTGGCTTTGTCAAGTACGT
TCCGCGCGTTGCTCAACAGCTCAGGCAACAGCTGCTGTCTTCCACTGTTCGACCCACGTCTGCGGGCCATTGGCCAGATC
AGCTTCCACACACAAGTTGTCAAGCCTTTTCCCGGAAAGCCCCTGGAAATTGCAGACTTCGAGACGTACTGGAAGGCCAC
CAGCCAGCTGGATGGCCATCCCAGCACTTTCATCGCCGGCTCAAGCTTGTCGGGAGACTACGTGCGCGTCTATGTTCAAA
ACACAAGAGACGGCGTACCTGTGTTGTGGCCGACGTGGACGGTCAACTGTGGAGGAGGAGGAGGGTGTGCATCTACTCCT
GGCACTTGCGGTGGTATTGATATTCCGGTTGCCCGCCTGACCTACGACGAATTCCTGACGGCCACGGCAGCCGGGCCCGG
ACGGTCGCAGCTGGCGAGCCTGCCAAAGTATTCTGCTTGTGATGCTGCCATTGTACATCAGGTACTTGCAGCTTCTGGCG
TGACTCTTCGCGACGCCCTAGCGCTGCTGCCCTCCGGGATGCACGTGAACCTAGAGCTCCTGTACCCCAGCGCCGACGAG
GAGCGGGTGATGGGGCTTGGTGGTTCGGGCAGCGTGGATCTGAACGCATTTGTGGACTCAGTGCTGGCTGTGGTGTTTGA
CCATGCGCGAGCACAGCGGGCACACACTCCCGACGTGGTGCGGTCAATGGTGTTCAGCTCATACAACCCAAGCCTATGCA
CGGCCATCAACTGGAAGCAGCCCAACTTCCCTGTCTTCCTGTGCAACGACCTGGGACGCGAGGACGACGCTACGGTAGCA
ACCATCGTGCCGGAGGCGATATTGAGTAGCGGCCGACGCACAGCATCGGTCAAGGAGGTGGTGCGGACGGCGCAGAGCAA
CAACTTCATGGGGCTGGTGTGCAGTTCGAGGCTACTGGTGAGTCTTTTGGTCTTTTGAGCGTCCGTGTCTGAAAGTGCTG
TTCGGCGGCTAACTGTCCAGGATATGGTCCCGGCCCTAGTGGACGCGATCAAGTCTCAGGGGCTGATCTTGGTAGTAGAC
AAGTCGGCCGAGCAACCGCGAGGGTTCGGCCCACTGCCAAAGGGCATCGACGGTGTGCTGAAGAGCGACGGTGTGTTGCG
ATTTAACGAGTCGATCGACATGTGAGAACAAGAACAAAGGCAGTGGGGATGGGACGAATAAGGAGGTCTAATATGTATCT
GATTGGATATCACGAGCAGGGAAATGGACACGGCGGAGGAGGGAGAACTGACTGGCGGCTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62