GenePrediction:GLEAN_5141 Details

Name: GLEAN_5141
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1558758..1557327 (- strand)
Length: 1432
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1558758..1558670 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_97:1558617..1557327 (- strand)
Length: 1291
>GLEAN_5141 class=GenePrediction position=GCSC_97:1558758..1557327 (- strand)
ATGGCATTGCAGACGGAGGCACCGCTACGTTGTAAACGATGCTCGGTCAATGATGCGGTTCTCAAGATCCGGATAGACCA
TGTCTGCAGGTGAGCGTGGCAGACACTTTCATCTCTATCCTGTTCCTGACATTCCCTGTAGCGACTGTTACTGCCGTTTT
ATTGCCACCAAGACGGTGAAGCGTCTCGAGGTGCTGAACCGAGACACCAGAGGCACCACACCACAGCATCGCCAAAAGGT
AGGGTCGGCCTCCGAATGGCGGGCAAACAACAGCAAGGCGAGCTTTTTGCTCGGCTTGTCTTTTGGACAATCCTCTGCGT
CGCTCGTGGCCATCTGTGAACAGATTGTCGTCGGCCGGCTAGCCAAGGGCCGAGACGCAGCCTTCACGCTGCATGTCGTG
CATGTCGACACCGATCTCCAGAGTAGCGAAGCAGACAAGAACGGTGCTAGCAGCGAGCAATCTCGCGTGACGCAGCTGCT
GGACCGCTGGCGTCTGCGGTTTCCGCGCTTCACGTTCGAGCGTGTGCCGCTGGCCGATGTGTTGGAGCTGAAGGCGATGG
ACTGGTCCCTGCTGATTCCCCCAGGATCCGAAGAGATGGAAGAGAACGGTGGCGCTGCTCCTTCCTCCCCTCTCTCCCCA
GCTGGCCGGCTTCGTGCCATGCTGTCCCGCCTGCCGTCAGCATCGTCACGACAGGATGTGCTCGACATGCTCGTGCGGCG
GCTACTCATCGCCCGTGCTGTCGCGGCCAATCATCGCGCCCTCCTCCTTGGCTGCAGCACGACAGCGCTGGCCGAACGCA
CGCTGGCAGAGACGGCAAAAGGTCGCGGCTTCTCGCTTCCATGGCAGATTCACGACGGGCCGCCTGCTGAGGACACTGGT
GCAGACGCTGACGGATCGGCAAGGAGGCCTTCCACAAGCACGCTTCTGTACTACCCTCTGCGCGAGCTGTTTCGAAAAGA
GCTCGTGACATACACGGGCTTGACGCAGCCGTCGCTGGCAGATCTCGTCTTTCCACCGCTGCCATCGGCCGTGTCGCCCC
TGTCCTCTGCGCCCGCCGCGACCCCTCCCGCCGTCGTCTCACACAAGCACCTCAGCATCGAGGAGGTCATGGCCCGCTAC
TTTGCTGAGGTCGAAGAGAACTACCCGTCGGTCGTGGCCAACGTGGTGAAGACGGCGACGAAACTGGAGCGTCGGGACGA
TGTTGACGATGATGAGGACACGTGGACACGAGCATCAGAAACCACAGGAGAAAGAACCACAAGGAGAAAATATCATGGCT
GTGGCATGTGTGGCATGCCGCTAGATGACTTGGGGAACGAGCGGTGGAAGGGCGAGATTGGGGAGCTTGACAATATAGAC
AACACTGGTAGCCAGCAGTCTTCAGAGCCGCGGAGGCTTTGCTATGGCTGTGAAAGATCGGTAAAAGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62