GenePrediction:GLEAN_5142 Details

Name: GLEAN_5142
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1555153..1553932 (- strand)
Length: 1222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1555153..1554796 (- strand)
Length: 358
Type: CDS
Source: GLEAN
Position: GCSC_97:1554716..1553932 (- strand)
Length: 785
>GLEAN_5142 class=GenePrediction position=GCSC_97:1555153..1553932 (- strand)
ATGGACATCGACTCGCCAGCCGCAGTGCCCGCAAGCCATCTGGGCAACGGATCTCTCAATATTCCTAGGACGCTACGCGA
AACCACGACAGAATTGACCACCATTATCTCCAGCTTCCGGCCAACAAAGCTGTTCGCGCGCGAGACAAAGGAGAACAAGC
CGACATACATCCTGTCGCTCGACTTTGATGACCCAGGCGAGCTATGTATGACCTCGGAGAGCGACGAGACTCTCCAGATC
TACAACGTCAAGGAGGGCCGCCACGACAAGTCCTTGATCAGCAAGAAGTATGGTGCAAAACTCGCTACCTTTACCCATTG
GTCTTCTAGCATCGTGTACGCAAGCACAAAACAGAACGGTTCGTTGAGGACTTCATATTTTGCCTGTCCGCATTGGCTTC
CGTGTGCACTAACCGGCTGCTCTTCCCCTCTTCCCAGATGCCATCCGCTATCTTGCCACTCACGACAACTCGTTCATCCG
CTACTTTGAAGGCCACGACGGGCCCGTCACCTCCATCTCGATGCATCCCGGCAGCGACAACTTTATCTCGTCCAGCCAAG
ACGGCACAGTCAGACTATGGAACATTGGCAGCAAGCAGTGGACCGGCCTCCTGTATCTGACAAAGCCGTATCTCTCCGCG
TGGGACCCTGCCGGCAAAGTCTTCGCCGTCGCCTCGCCTGCCAGCGGGAGCGTGTTGCTGTATGACTACCGTAACTATAC
CAATGCTCCGCTCTACATCTTCGACATTGTCGAGCAGTGTGGTGCTGTGGACAAGCGCAATCTGCTGCAAGGCTGGACCA
AGCTTGCCTTTTCTAATGACGGCAAACACCTTTTGGTCGGCACCCGCGGTGCAGGACACTTTTTGCTGGATGCCTTTGAT
GGTACCCTCAAGGCATTCCTGCACAAAACCGCAGAGCCCACCCGTCGCGCTGCCGTCGGGGAAGGGAATATCTCTGCAAA
TGCCACGAGCGACTCCTCGCGGTTCGAGACCAGCGGCGACTGCTGCTTCACGCCGGACGGACGCTACGTCTTGGGCGGCA
CGAAACAGAACGTGCTCGTGTGGGACACTTTGGGCACGGTCAGCGACAGCAAGGTGTTGAGTCCTGCCTTTGTTCTGGAT
GACAAGCGGGAGGGCGCCGTGGTCGCCTTCAACCCGCGGTACAACTTTTTCGCCACTGCCGACCAGTCTCTCGTCTTCTG
GCTGCCCGACGCAAACGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62