GenePrediction:GLEAN_5144 Details

Name: GLEAN_5144
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1547044..1543926 (- strand)
Length: 3119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1547044..1547029 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_97:1546936..1544720 (- strand)
Length: 2217
Type: CDS
Source: GLEAN
Position: GCSC_97:1544269..1543926 (- strand)
Length: 344
>GLEAN_5144 class=GenePrediction position=GCSC_97:1547044..1543926 (- strand)
ATGAAACTAGAAGACTGTAAGTCAGGCTGCGGCATTTCGCCGCTTGGGTCTCTGGCTCTCGACCCGTCTGGCCCCCGCTG
CCGTCTCATGCCGAGCTGACTCTACCAGGGCTGGACGACCTCTGCGTCCGCTTTATCAACAACCTTCCCGAAGCAGACTT
GACGTCTATGGCACGAATCTGCTTCCTTGTTGAAGAAGCCCACTGGTTCTACGAGGATTTTATCCGTCCTCTCGATACCA
GCCTCCCATCCATGAACCTGCGCAACTTCTGCCTCGCCATCTTTCAGCGATGCCCACTCCTCGCCCCCTTCCCCATCCAA
GATCACGTCCGCGCGTTCGAAGAATTTCTCAAGTACAAGACCAGTGTCCCCGTCCGCGGTGCCATCTTGTTGAACGCAGC
GATGGACCATGCTCTGCTCGTCAAGGGCTGGAAGAAGGGTGCCAATTGGAGCTTTCCCAAGGGCAAGATCAACATGGACG
AGGACGACTTAGACTGTGCCATCCGCGAGGTGGCCGAGGAGACCGGCTTCGATGTGCGGGAGGCTGGTTTGGTGCCACCT
CCGGAAGATATCAAGTTCATAGAGTCGACGTATCGCGATCAACAATTGCGTCTGTACGTCTTCCGTGACGTGCCCATGGA
TACATTCTTTGAGCCGAGGACGCGCAAGGAGATCAGCAAAATCCAGTGGTACAAGATAGCCGATTTGCCAATCTTCCGGA
AAAAGAGCGCCAGCCAGGGCCAAGATGTCGATGATCCGGCGAACGCTCCACATGCACCAAAGTTCTACATGGTATCTCAG
TTTGTCGGGCCACTTAAGAAGTGGGTGGCATACCAGAAGAAGAGGGATGCATACCGTGCCGGGCATACCAACCTCGTACC
ACAGCCGCCAGTTGCCGACGACGGCCTCACCGAAGATGAGACCGGTGCACAGTCAGAACCACAGTTCCAGGGCTACCAGA
CTCAGCCACCGGAGGGGATTCTCGACAGCGCCTCCAGGGAGCTCCAGCGGCTACTTAAGACGCAGCCCTCTCCTGCAAGC
CGGTCTGCATATGACGATACTCTGGCTTCGATGGATCCGACCGGCTCGGCCGATCCGAGCCAAAACAAGGCCAACGCTCT
GCTCGCCATGCTTCAGAAGGGTGGGGATGACAGAATGAGTCCATCTGGATCTCAAGCGTCACTCAATCACTCTTATGGTC
AGGCACCACAACCGAATGCGCCACATCAACCAAAACACCAGGAACCATACGGCCCCTACGCATCTCATTCGTTTCAGGCA
CAAGCACAACAGCAGCAGCAGTCGGCACATCCGCCGCTTCCATTCCACCAGCAGATGCCTTCTCTCGACCAGAGCCACGG
TCAGGGCATCTCGGGGGCACAGTACAACCAGTATGGAGCACCGCATCCTGACATGCCGCGGCACCTTCAGTCACGCCAGC
CGCAACAGGCGCAGATGCAGCACCAACCTCAGAATTACCCGTATCATCAGCAACAGCAACAGCAACAGCAACAGCAACAG
CAACATCAAATACAACATGCGCAGCAAGCGCAGCAAGCGCCACAGAATAATCAGCGACAGTATGCGCCAAACTATGCGAA
CCAGCCGGGACCATACATGTTCCCAGGAAACGCAGCTGGGGCGATCCGACAGCCACAGCTACCACCACAGCTGCGGCCCC
CGATTCCGCTGCTGCACCCCCAGCCATTGCCACCCACGGTGCAAAAGGGGCTGTTGGCTAGGGAGTCATTTGCCTCGCCG
GATGTAGGCGAGTCTGGCCGCAATGCTGCTGGAGGCTATGCCAATATGGCGGCCCCTCTTCCGTCGCAGAATATGGCAGC
GCAGCGGCCGCCTTTAAGTAACCACGCGGCGAGCCTTCTCAGCGCTTTCAAATCGCATAATGGAGCCCGTCCGGAGTCTG
GACCTGGTTCGGGAGGTGCTCCTATTTGGCAGCAACCGCAACCACCACCGCAGCAGCAGCAGCAGCAACAGTCACCGGTA
CCAGTGCCCAATGTACGGCAGCAATACGGCGATGGCACACCTGAAGAACACCACCTTTATGGCTCACGCATGCAGCCAGC
GCCACAGATGGGGCCGCACCCGGGGCCGCGCCCGCAGCCAGGTCCACAGCAGCAGTATGGCAATGGACCGATGGGTTCTG
CCGGCAGCTACGACAACAGCAACAGCCCCAGGAGCGGTTCCAACAGCTTTGGCCGACCGCAGCTGGTTGGGTCGTTCCCT
GGAAACCAGTACACGCAGTTTGGGCCCAATGCCGCAGCCCCACGGCCTGGCCAGCCCATGGACAACCATCGAAACGCTCT
GCTGGGTATATTCAAGCAGCCACAGCCACAGCAGTCGCAGCCGCAGCTAGAGCCAGAGCAGCTAGAGCAGCAGGAACAGC
AGCAGCCCCCACCGGTGCCACAGAAGATACCCAGTACATACGGCGATAACTCGCCTAAGGGCCCAGCTTCCGAGACCGAT
AGGGAGCCGTCAGCTGCAGGACTTCAACTTCCGTTCGGTGGCATGTCGCTGCTTAACCGGCCGAAGGGGTCAGACACGAG
CGGTTCTCTTCGGTCCATTCAGCACCAGCAGCAGCATCCGCAGCAGCATCAGCCACATCAGCCACACCAGCCACAACAAT
CGTACCAGCCACACCGGCAACAACAGCCGTCACCATACGAGCAACAGTCATCACCGTACCAACAGGGCTCTGTGCGCCAG
CCCAGCCTAGTATCGACACCGTCTACGGAACCTCCGCCTCAAACCACGTCTTCAGAGGGCGGCAGCGTTGGATTTGCGCC
TCCACCGACGACATCATCACGGCGGTCAGACATGAGCTCCGATCACAAAACTAAGCTTCTGTCTCTGTTTGGTATGCCAA
AGCTATCGCCGACGGCGTCTGTGAGCTCTCGGGGCAACTTCGATCCGCGGTCCAGAGAGGCTGGACCAGGCAGCGCGGGA
GGGGGGGTAGGAGGGCCGCTGCCGGTCAACGTAGCGGCCAATGTAGCAGCAAGTGCAGCTTCGGAATCGTCGAGACGGGG
CAGCGCTGCCCAGACGCCCATCTCTTCGGCAGACCGGCACTTTCTGTTGGATTATCTCGCTTCGGCAACGAAGCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62