GenePrediction:GLEAN_5145 Details

Name: GLEAN_5145
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1543045..1542077 (- strand)
Length: 969
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1543045..1542464 (- strand)
Length: 582
Type: CDS
Source: GLEAN
Position: GCSC_97:1542397..1542077 (- strand)
Length: 321
>GLEAN_5145 class=GenePrediction position=GCSC_97:1543045..1542077 (- strand)
ATGCTCTATAACACCACACCCGACCAGCTCTACGAGCCGCGCGCCGCCGTCGACCCTCTCGGCTACGGCCGCGTGGCCAT
TGTCACCGGCTGCGCCTCGGGCATCGGCCTCGCCTGCACACAGCTTCTGCTGGCTCATCAGTTCTACGTCTGCGGCCTCG
ACCGACGTCCGTTTGACTACGCCAAGCTGCTGCGCGCCACCGACCACGGCCGCTTCCACTTCCATCAGTGCGACCTCACG
GCGCCCGGCGCCTGTGATGACGCCGTGCGCATTTGCCACCACTCGTTTGGCGGCACTAACAATCTCGACGGTCACATCGA
CGTGCTCGTCAACGTCGCTGGTGTCATGGATGGCTTCGCTAGCGCTGACACCGTATCTGATGCCGTCTGGGACGGGGTCC
TCGCCGTCAACCTGACCGTGCCCGTGCGCATGATGCGCGCTGTTCTGTCATCCATGGTAGCATCGTCCCCATCCTCGTCC
TCTTCGGCCTCGCCCGGCGGCGTCATCATCAACGTCGCCTCCACTGCCGGCCTCAGCGGTGCTGTTGCCGGAATCGCCTA
TACTGCCTCGAAGCATGGACTGGTACGTCGCCTCCTCTTTGATTTTTTGTTGTACTTTCATCTTATTTTCCTTCCTTCTG
ACCTCCAGATCGGCGCTACAAAAAACGTCGCCTGGCGCTTCCGCCATGAAGGCATCCGCTGCAACGCCGTCCTGCCCGGT
TCAGTTGACAGCAGCATCGGCCAGGCCATCGCCGGCCGTGTCGAAGGTGGCCTGGACTCGGCCGGATTCGCCCAGCTCGC
CCCTGTCCACGCTCTGCAAGCACGGCCAGCCACTGCGGCTGACGATGGCAACACAACGGACATCACCGCTCTTGACGTAG
CCAAGGCTATCGTGTTCCTGCTGAGCGACCAGGCACGCTCCATCAACGGTGTATGCCTGCCGGTCGACAAGGCATGGGGG
GTGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62