GenePrediction:GLEAN_5146 Details

Name: GLEAN_5146
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1538240..1537239 (- strand)
Length: 1002
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1538240..1538117 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_97:1537822..1537239 (- strand)
Length: 584
>GLEAN_5146 class=GenePrediction position=GCSC_97:1538240..1537239 (- strand)
ATGAAGGCATCACGATCGTTTGGGCAGTTGGCTGCGGCCATGCTCTCGGTGTCGACTGTGGTCGCTGCATGGCCGAGCTT
TCTGCCGGAGCTGGACAAGTTCATCGTGCGGAGAGCCGAGACGAGTACGTGTGCACGGGAGGGGGAGAAGAGAGCGTTGG
TATCGGCGGGACGTGGGCTAACGTGAGCAGCGGACGCGGCCAACACATTCAAACTAAACACAGGGACGGAATCGACGGCG
ACGCCGACGGCGACCAAAGAGACAGCGTCCAAGACGACAGAGAAGGCGACAGCGACGACCGGGACGACGGGAACGGGCAA
AACAGCGACGGGGACGGCAAAGACGACGGGGACGGGGACGGAGACGGGCAAGACGACGGCCAAGGCGACGACGGGCAAGA
CGACAGGCAAGACGACAGGCAAGGCAACGACAGGCAAGACGACGGCGAGCGCCAACTCGACCACCCTGGTAGGCGGGGCA
GGCGGGATCACGCTGCTGACGCCGACGACGGTGACGGGAGCGACGCAGCTGTACAAGATCGGCGACTACGTGACGTGGGT
GTGGAACTATACGAGCCTGCAGGTGACGCCGACGGCGCTGGACGTGCTGGTATCGTGCAGCTTTGCGACGAGCACGTACA
CGCTGACGCAGAACATGACGTTTGAGACGCTCGGCAGCTACACATGGGACACGGCGGCCTACGAGACGGATCATGTGAAC
GCGCAGCTGCTGACGCAAGAGTACACGCTGATCATCTACGACGCCGACAGCAAGATGACGGCGGCAGCCGAAGCCGGCTA
CCTCGACACGTACGACAGCTTTACCTTTGGCATGTACGCGGCGCAGTCGTACACGGGCCTGGCCGACGGCTGGACGTGTG
CCACATGCAGCGGGGCGGTGTCGGACATGGAGAAGCGGGCGCTCGGCTTTGCCCTGACCATGAGCATGGTCACGGTCTTG
AGCTTCACCTGGTTCGTCACCGGCATGCGGCTGACGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62