GenePrediction:GLEAN_5147 Details

Name: GLEAN_5147
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1535075..1533217 (- strand)
Length: 1859
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1535075..1534857 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_97:1534804..1534532 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_97:1534466..1534265 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_97:1534211..1533217 (- strand)
Length: 995
>GLEAN_5147 class=GenePrediction position=GCSC_97:1535075..1533217 (- strand)
ATGATACAGGCACTAAGACAGGCAGCTCGTCCGAGCACGGTGCTGCTCTGCCGTCCGACCGGTCTTGGTCGGCCACGACT
GCTGCTGCCATGGCGCACAGCTTCTCGCCCTCGGCACCCTGGCTGCCGGGGCTTCTCGTCTTCGGGCGCGCAACACGAAG
CGGCCGCGGAGCGCAGATGGTCCACGCCGCTGGCCAAGCAGCTAGCCGAGGCGATCTCTGTAAGCATCGCACTACCTACT
ACAGCTGCACCGTGTACATGCTAACCCACAGGCCACCGGTCCCGTTCCTGTGGCGAGCTACATGCGCATGTGTCTGACCT
CGGATCTGGGCGGCTATTACACCGGCGCCCTGGACAAGACCGGCCGTGACCCGTTTGGGCGCGCGGGCGACTTTGTCACG
TCGCCCGAGGTGTCGCAGGTCTTTGGCGAGCTGGTCGGCATCTGGTTCGTCGCCGAGTGGATGGCCCAGGGCCGGCCGTC
GCGGGGCGTCGAGCTGATCGAGGTCGGACCTGGCCGTGGGACCCTCATGGACGACATTCTCCGGGTCCGTTGCCTGTTCT
GAGCTGTTGTGCGGTTGTTGCCCCAATGCTTATGTGCTGACTAAGCAAGACTGTCCGCCATTTTGGTCTGGCCCAGAGCA
TCGAGTCCGTCTACATGGTCGAGGCCAGCCCACAGCTGCGGCTGGCCCAGAAGACCCTGTTGTGCGGCCACGATGTCGCG
CTGACCGAGTCCAGCCTGGGCTACCACGGCGTCAGCAAGCATGGTTCGCTGCCGATTGTCTGGACCGAGACGATCCAGTC
GATTCCGCAGAGTGAGTCTTCCGAGAGCTGACCTCTTGTCTTTTGCGCCCGTCCTGACCTAAAGGCCTGGAAAACATGTC
CTTTATCGTCGCCCACGAGTTCTTTGATGCTCTGCCCATTCACGTCTTCCAGTCTGTGGCCGTCCCGGCTGGCCAGGGCT
CATCGACAGAGGGCAGCTCGAGAGAGATCGATACGACCACTTCGACCATTCCATCTTCCTCTACCATCACCACCTCCACC
ACCACATCCACCACCTCCACCACATCCTCCACCACCACTTCTCCTATCCCCTCCTCCACCTGTACCTCCTCCAACTCCTC
TTCCTCCCATCAGTGGCGCGAAATGGTCGTCTCGTCCACGCCACCCGGCTCAACCCACGACAGCCTGCGCACCCCCCCCT
CGCAGCAGCGTGATGGCCCGCCGCCCGACTTCCAGCTGACCCTATCGACCGGAGCCACGCGCCACTCGCGCTACCTGCCT
CAGCTGTCGCCGCGCTACCAGGCTCTGGCCGCCATCCCGGGCGTCGTCGTCGAGGTCTGTCCAGACGCCGCTCTCTACGC
TACTGACTTTGCCGTGCGCATCGGCGGCTCTGCTGCTCGGCCACGACCGCATCCTGCTGGCGCTGCCCTCATCCTCGACT
ACGGCCCCGGCGATGGCACCGTGCCCATCAACTCGCTGCGCGGCATCCGTCGTCACCGTCGTGTCAGCCCCTTTGCCGAA
CCCGGCCTCACCGACCTCAGCGCCGACGTCGACTTTGGCGCCATCGTTGAGGCAGCCGTCCGCGCCAGCGATCGCGTCGA
ACTCCACGGCCCCGTCGATCAGGCTGACTTCCTCCTCCAGATGGGCATCCGCGAACGCGCCCAGGCCCTCGCTGCCAAGG
CCGCTGCCAGCCCTGCCGCTTCTTCCTCATCTACCCCCTCCGATATCGACCGCTCCTGGAAACGCCTCGTCGATCGTGGC
CCCGGCGGCATGGGCAAGGTCTACAAGGTCCTCGCTATCCTCCCCGAGAACGATGGTCGTCGTCGTCCCGTCGGCTTCGG
TGGCGATGTCGCCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62