GenePrediction:GLEAN_5148 Details

Name: GLEAN_5148
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1528304..1526653 (- strand)
Length: 1652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1528304..1528193 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_97:1528132..1527915 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_97:1527846..1527424 (- strand)
Length: 423
Type: CDS
Source: GLEAN
Position: GCSC_97:1527369..1526653 (- strand)
Length: 717
>GLEAN_5148 class=GenePrediction position=GCSC_97:1528304..1526653 (- strand)
ATGGCAGGCAATTCAAAAACAGTAATTGTGGGCGCCGGACCAGTTGGATCCCTCGCTGCTCTCTATGCTGCTCAGCGAGG
CCATGATGTGGAGATCTATGAACTTCGCAATGGTGAGTAAAGCAGCCGAGGTTGTTTTTTATAAAACCGCTTGTTGAAAC
TCTCGCCAAAAGATCTCAGAGACCCGCTCACGACGCCACTCCTTTTCTCAAAATCCATCAACCTGGCACTCTCTGAGCGG
GGGATCAATGCGTTGCGGCAAGTCGAACATGGTGCCTTGTTAAGCGAGGTTTTCAAAACTACCATCCCTATGCGTGGTCG
TATGATCCACGGGAATAGGCCGTCTGGCGAGCTCTATGAGGAAGCGCAAGACTATGACGCCCACGGGCGGGTTTGTTTTC
CCCTTCTGCTAGTCTATGCATGCCGACAAGTCTTCTGACATTCAGGTTTTCTCGGAAGACCATTTTTGCTGTCGACAGAA
CTGGGCTAAACGGCTGCCTGTTGGACGCCTTGGAACGGACGCCTAATGTGAAATTCTTCTTCAACCACAAGCTTACCGGC
GCTGATTTCCGGGCCCGAAAGGCCTGGTTCGAGGTGCAGGATGCTGGGGTCAAGGCTACTGGCCGGGCGCGAGAGATTGA
AATAGATTTCGACTTGCTGATTGGCGCCGACGGTGCCCACTCTTCTGTCCGATATCATCTGATGAAGTATGCCCGGGTGG
ACTACAAGCAGGAGTACATTGATGCTTTGTGGTGCGAGTTTCACATGGAGCCTCGGAAGGAGTCCTCGCCAGAAGATCCC
ATGTCTCGATTTGCGATATCTCCCAACCATCTTCACATCTGGCCTGGAAAGAAGTTTATGTTCATTGCTATCCCCAGCGA
TGTAAGCAAAAGACTATTTCGTCGTCAGGATGCAATCCACTGACAATTCGACCAGGACGGTTCATTCACATGCACACTGT
TCATGCCATCCGCTCAATATGCCGTCTTGGAGACGCAGCCTTCTGAGGTTCCGGCCTTTTTTGACCAGCACTTTCCGGGG
GTGACAGCTCTGATCTCCCCTGACAACCTTATTGCATCCTTCACATCCAACGCGCACCTTCCACTCATCAATGTGAACTG
CAAGCCGTACCACTTCCAGTCGTCCGTGGTGATACTCGGCGACGCTGCCCACGCCATGGTTCCATTCTATGGCCAAGGTA
TGAACTGCGGCTTGGAGGATGTGCGTATCCTGTTCTCGATTCTCGACAAATACGAGACCATGGACAGAAACGCCCCTGAC
GACCAGAACGCACAAGGGATACAGCTCACACAACGAGCGCTTGCCCTGGCTGAATACACCGCTCTGCGTGTGCCTGACGC
CTTTGCCATCAACGACCTGGCTCTGAAGAACTATATTGAGATGCGGTCATCTGTGCTGAGCCCGACATACCGCCTGCGGA
AATATCTTGAGGAGCAGCTGTCGCTGTACTTCCCGAGCCTGGGCTGGAAGACAAAGTACGCGCGGGTCTCTTTTGGCAAT
GAACGATACAGCGATGTAGTGAAGAAGAGTGAGCATCAGGGCAAGGTACTTCTCAATGCCTTTATAGGTGCCATGGGAGT
GCCGATTCTTGCCGGCACTATTGCCCTATTCTGGAGGTACAGACGTTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62