GenePrediction:GLEAN_514 Details

Name: GLEAN_514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:280714..284817 (+ strand)
Length: 4104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:280714..280871 (+ strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_97:280940..283096 (+ strand)
Length: 2157
Type: CDS
Source: GLEAN
Position: GCSC_97:283161..284817 (+ strand)
Length: 1657
>GLEAN_514 class=GenePrediction position=GCSC_97:280714..284817 (+ strand)
ATGAGGAATCTGCGGGCGGTCCGACTGGATGTCTGCGGGGAGGCGGCGGGGGCGACGGCGGCATGTTGGGACGCAGCGGG
CGACTCGATGATTGTGGTATTTGGGCCGACGGCGGAGGAGCCGCGGGTGCGTCTGGCGCGCGTGGACGGGGAAGTGATGT
GAGCAGGCAGCGAGGGGACCAAAGAGAGAAAGAGAGAGAGAGAGACCCAGCTGACAGACATTGCAGGAAGTGCCATGAGA
TTGCCTCGTGGGAGGCTACAAGTCCGCGGCCAGACATGGTGACCGACCGGGTGGTGGGACTGCATTACCTGAGCGACCTG
GCAACGGCGTGCGTGGTGATGGCGGGCGGCGACATCGTGATGGCGGGCGAGGACGGCGGCGGAGGCGTGCAGGTGGAGAT
TGTGGGATCGGTGGACGCGGGGATCGTGGCGGCGCGATGGTCACCAGACGAAGAGGTATTGGCAGTGGTGACGGGGGGGG
GAGAGAGCGAGAAAGAGAGCGGACCGGATGCGAGAGGGTCTCTCATTCTGATGAGCCGTGCCTTTGAGCCGATTGCGGAA
ACGGTGTTGACGGCCATCGACTTGGCCGCGTCCAGACACGTTTCCGTCGGCTGGGGCAAGAAGGAGACGCAGTTCCACGG
CCGTGGGGCAGCCAAGGCGCTGCGCGACCCAACCCTTCCGCAGACGGTCGAGGCAGGCGTGCTGAGCCGACACGACGACG
GGACAGCCGTGACGGTCAGCTGGCGTGGCGACGGCGAGTACGTGGCCGTGAATGCGGTCGTGGAGGCGGCAGACGAGGCG
AATGGCCGGGCACGCCGCGTGGTGCGGGTGTTCAGCCGGGCAGGTGTTCTCGACAGCGTCAGCGAGCCGGTGGACGGGCT
GACACAAAGTCTGAGCTGGCGGCCAGCTGGAAATCTGCTGGCAGGCGTGCGATGGGGACATGGTGGCTGGAGCGTGGTCT
TTTTCGAGCGCAACGGTCTTCGTCACGGGCAGTTTGACTTGCGGGAGCCAAAGACCGAAGGAGACGGAAAGGAGGACGAG
ACGGAAGGCACACCCTCTCTCGAATGGAATGCCGACTCGACCGTGCTGGCGGTTGTCTGGCCGCAAGCCGTCCAGCTCTG
GACCACGGCCAACTACCACTGGTACCTCAAGCAAGAGATTTCGCTTCGGAAAGCGATCGCCGTCTGCTGGCACGCCGAGA
AGCCGCTGCAGCTGCTGGCCGCTGCTGCCGACCGGCTCGTCTCGGCTGTCTTTGTGTTCGCCGTCGTTCGCGGCACCATG
GCCCCGCCTCTCGACCATGGTGCCGTCGCCGTGATCGATGGCCGTTTTGTTTTGCTGACGCCGCTGCGTGTCGCCACGGT
GCCGCCGCCGATGAGCCTGTGTGCGGTGACGGCACGGTGGCCGGCCGTGGACGTGGCGCTAGGACCGGGCGACGGCGTCG
TGGCGGTGGCCCATGGTCATGGACTGGATCTTTGGTCGTGGTGGGAGGAGACCAACAAGAAGCAAAAAAACGCCCCACCT
GAACCCATGGCGACGGCCGACTTTCCCGGCTTCACGCCGCTGCAGATCGCCGTGATCCACGACGACAATAGCGACAACCT
CTCTGTCTGTGTGCTTGGTCGCGACAGCTCCAACAGCACGGCCGTCGTCACGTTCGCTCTGTCCGCCCGGACGCTGGTCT
TGGTGTCGACCGTGGCCGTCTCGGCCGGCTCGACCCTCCTGACCACGACAGCCGCCCGGCCAAATCGCCTTCACCTGCAG
GACAGCAGCGGCTCCATCGTGCCGCTTGGCTTGCCGCACGTGACCGCGCCCGAGCCGACGGGGGCTAAGCTGCCGGGACA
GCTGCCCTGGGCTGAGCTGGTCGAAGCCTCTTCTTCGTCTCCTCTCGTCGTGGGTCTTTCCCGCAACGGCTCCCTCTATG
CCGGCGACCGGCTGCTGGCCCGCAACTGCACCTCCTTTCTGACCACACCCGACCACCTGGTCTTCACCACCGGCAGCCAT
CTGCTCAAGCTGGTCCACCTCGATTTGGCGTCGAGTTCCGATCTCGTCGTCCCCCTTGACGACCCCGAGACCGACGAGCG
CTGTCGCAGCATCGAGCGTGGTGCCCGTCTCGTCGCCGTCGTCCCGTCCACCTCGGCTGTCGTCCTGCAGATGCCGCGTG
GCAACCTCGAGACGGTCTTCCCACGCGCTCTGGTCGTCGCCAGCATCCGTCGACACATCGACACTCTCGATTACGCCCGC
GCTTTTGCCATCTGCCGCGTCCAGCGCGTCGACATGAACATCTTGTACGACCACCGGCCTGCACAGCTTTTGGCGCACGT
CGACCGCTTTCTCGCCCAGCTGCCGGACGTCGCCGCCGTCGACCTGTTTCTGTCTGCTCTGCGGTGAGTACAGTGCATAC
ACCGTGTTTGTATTATTCGCACTGTTTTACATCAACTAACAAAACAGCGACGAGGACGTGTCCCAGACCATGTACAAGGA
CACAAAGGCCGTTGCAGCCACCGGCGTGGCAACCACGCCGTCCGCTTCATCCAAGGTCAACACCATCTGTGACGCCGTGC
TGGCCAGCCTGCTGAGCAGTCCGGCCGGCCCGACCGCCCAGCAGCTGCAGAACGTGATCACAGCGCACGTGTGCAAGTCG
CCGCCCGCGCTCGAAGACGGGCTGCGAGTGGTGGCGCAGCTTCTGGGGACGACGGCGCGCGACCCGTTGGCCGACCGGGC
CGTCGAGCACATCTGCTTCCTCGTCGACGTGCACCGGCTCTACGACGCCGCCCTGGGCCTGTATGACCTGGGCCTGGCCA
TGGCGGTGGCCCAGCAGTCGCAGCGGGATCCGCGCGAGTACGTGCCGTTTCTGCAGGCGCTGCACGTGACCGAGCCGGAG
CTACGACGCCGCTTTGTGATCGACGACCATCTGGGCCGTCACGAGCGTGCCCTGACGCACCTGCAGGCTCTCGGCGACGA
CGCCTTTGCCGAGCTGCTGGCGTACGTCGACCGCCATCGGCTGTACCGGCCGGCCTTGGGCCTATACCGGACGAAGACGG
CCGAGCGTGCCCGCGTCACCGAGCGCTATGCCGCCCATCTCGAGGCGCAGTCGCGCTTCCGCGAGGCCGCCCTGGCCCAC
GAGTCGCTGGGGGACGCGTCCGCTCATCGGGCTGCCGCCGTGCGCTGCTACCGGTCGGCTGGTGCGACTTGCTGGCGTGA
GTGCCTCTTCGCGGCCGAGCAGCTGCACGACCGTGCTGCTCTCGTCGACATTGCCACCACCTTGGCTGAGGCTCTCGAAG
AGTCACGTGACTTTGTCGCAGCCGCCACGGTGCATCGAGAGTACCGGGACGCCGTCGAGGCGGCCGTCCGGTGTCTCTGC
CGGGGCCACGCGTTTGCTGAGGCGATGCGCGTGGCGGTGCGTCACAGCCGGACCGATCTGCTGGCCACGACCGTCGACGG
CGGGCTCGGCGACGCGCTCTCGTCGTCGACCGAGCTCCTGGCCGACTGCCGCGCCCAGCTGCGCGCACAGGTGCCGCGGA
TCGTGGAGCTGCGCTGCAAGGCCGCGGCCGATCCGCTCTTTTACTACGAGGGCGACAGCACGACCGACAAGACGGACAAC
AACATGCCCGACGACGTCTCGGTTGCCAGCTCGCGCATCAGCACCGGTGCCAGCCTCTTCACCCGGTACAGCACGCAGTC
TGGCCAGACCAGAGCAACCGGCCAGACCGGCCAGACCGGCCAGACGACCCGCTCGCAGCAGCGCGCCCGCAGGAAGCGCG
AGGACAAGAAGCGCGCCCGCGGCCGCAAAGGTACCGTCTACGAGCTCGCCTACCTCGTCGGCAGCGTGCGACGCCTGGCT
GAGCGCATCGAACGCGCCCGCGGCGAGGTCGCCCTGCTGGCTGCCGCGCTCGTGCGCCGCGACATGGCGGATCGCGCCCG
CGCTCTCGAGGCGCTCATGGCTGAACTCGTCGCTGCCGGCCAGGGAGCGATCGCCGAGGTCTGGCCTCCGGACGAACAGC
AGCAACAGGAACAGCAGGAACAGCAGGAACAGCAGGAACAGCTCGTCGATAAGGAGGCTGCACCCGTCATCGCGCCCTTT
CAACGATTGTCCCTGCTTGGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62