GenePrediction:GLEAN_5151 Details

Name: GLEAN_5151
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1517459..1516243 (- strand)
Length: 1217
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1517459..1517357 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_97:1517159..1516425 (- strand)
Length: 735
Type: CDS
Source: GLEAN
Position: GCSC_97:1516364..1516243 (- strand)
Length: 122
>GLEAN_5151 class=GenePrediction position=GCSC_97:1517459..1516243 (- strand)
ATGGCCACCACTATGCTTCCCCACCATTCTCGGGACTTCATGGAGGTGCTGAGCCCCGAGGACTTTGAGACGGCCTCTAT
CCGCTCTGCTGCTCCGTCCTATTGTGAGTAACTCATCAACACCCTCATCAGGGCGTGCGAAAGGGCCTGGACTCCGGCTG
CTGGCGGGGCAGCCCTGCGGTCAACCCCGCGTGTGTCGCTATTTTGGCACAACCCCCCCTGCACCGTTCCGTTCTGGTCG
CCGATTGGCATGTCACCGATGTGGATTCTTGGCTAATACGGTTGTGCTCCGTGCATCCAGCTTCCGAAACGCCGTCAACC
CACTATACCGTCCCGAACCATGCCGGCGGCTCTTTGCCCCCGTACGCGCCACCGGAGCGTGTGCCCGGCGCCGCCTCATC
CAACCGCCACAATTCTGTTCCTTCTGCACAGTCGGCTCCCATGGCCTCGTCTGCTCGGCGCGCCGGCTCAGCATCAGCTG
CTTCCGGCCTACCCAGCATCGCGAGCTACGGGCTCTCTATGGACAACGATATAGGCCGTCGCGGCGAGATGCCCAACCTG
TCACAGTTTCGCATTCCGTCGTGGTCCAGCATCTCGTCGAACCCCAACGCCCGCCTCTACCACTCCGTCGCCCTGCGCCG
CGTCGCTGCTGCCGAGCACGCCTCTGCTGCTGCCGAGATCGGCGGCCTCATGCGACGTCTCGCCATTCTCGAGCGCGCCG
AGCTGGCGGAGGCTGTTGCATCTGCCCGCAACGGTGCTAATAATAGTGGCAACGCACGAATCGGCAGCAGCCAAGCCACC
ACCCGCCCTTTGGAGGATCCTCACCTAGTCGGAGAGGCTGCTGCTCGCCGTACCCGTGCTGCACGACTGGCCCGTGACAC
CCCTGCTCCTGCAGACGACGCTCTCATCCGCGAGGATCGGCGCTGGGACTGGTTTCTTGGTTCGTTTGCTCGCCCTTCCA
ATGTCCCCTCATCACGCCACGGCCTATCGCTCGCCCCGAGGCGCCACATCCGTCTGCATCCGGGCTTCATACGCTGTTAG
ACCTTGGACTTGGACCATCCCAGACTAACGACTGTTGCTTTGCACTTTTGTTTAGGCCAGATGAAGGGCCGTCACAGACC
CGGATGGAGCCAGTCGTCTTCCCGGATTCGCCGGCAATTTGATGTTACCAGACTGCCGGCCGCCACTATGCGGCACATCC
GTACTGGCCGTCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62