GenePrediction:GLEAN_5152 Details

Name: GLEAN_5152
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1512250..1508099 (- strand)
Length: 4152
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1512250..1512059 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_97:1511860..1509253 (- strand)
Length: 2608
Type: CDS
Source: GLEAN
Position: GCSC_97:1509193..1508334 (- strand)
Length: 860
Type: CDS
Source: GLEAN
Position: GCSC_97:1508263..1508099 (- strand)
Length: 165
>GLEAN_5152 class=GenePrediction position=GCSC_97:1512250..1508099 (- strand)
ATGGTGGACTATCCGTCGTCTAGCCGTAGGCCGGTACCTTCGCGGTCCCAGGAGTACGACAATGCGCCGGGGCACGCACC
AGGACATGCGCCAAACTACCAGCGAGATGCCGCCTTCTCCAACATATTCGGTGCTGCTCCTCCAGCCGGACGCTCCCAGA
CCATGACATCCATGACTCCGCCTGATCTGATGGTGTCACAGCACCCGCAGCATCAACAGCACCAACAGCACCAACAGCAC
CAACAACACCAACAACACCAGCAGCGTCCTCAATATGCACAACCGAGTGGCTACGATAATGAAAGAACTGCTTCCCTCCG
ACAAGGGCCGCCTCCCCAAAGAGGGATGGTGCCTGGACAAGGTGGACTGGGACCTGGGTACAACGAACAGCATTACGAGC
GAACGAGGACGATGGACTCGAGCTTGGCACATGTGTTGAGCGCTGGGGGCTACTATGCAAGACCCGGGCTGCGGTCTACA
TCAGGCGGTCCACCTGTGCCGTCGCCAAGCGCCCAGTATCTGCAGCAGCAGCAGCAAATGAGACGGTTTCCCGGCCAGCA
ACCGCCGCCCCGACAAGAGTCTCGTGCTCCGATGCCTGCGGCACCAAACCGAGGAGGTCCACCAGGCTCTGGGGGACCGC
CAGACCTGCGCACTCCTACCCAGCGTTATTACCAGAGCAACGGACCAGCACCGGCGCTGAACTCGGACGCGTACCGGACG
CAATCCCTTGCCAACATGCCTCGGCCGAATCCACAGGCCATGTACCAAGCGCCACCAACCCCGTACCAACAAATGCCTGC
CCAGGCTGGACGCCAACCGCAGTATGGAGCTGGCAATGTTGGCAGCGGTGCGGGCCAGCACCTGCAATCCAACACCACGG
CCCATGGTCGTGTTGTGCCTGGCCGCCACCCCGAAGACCGGACGATGTCCATGACTGGAGGGTTTGCCTCGCACCCTGAC
CGGGATGCGCATCAGACGATGAGCGGACGCATTATCCCGAACCGGAGAATGCCGGGCTCGCCGGGCAAGAAGGAAGGCGA
ACATGGACACCAGGAACACTACCACCAAGCCATGCCGGCAGCGCCCGGTACTCAGACGAGGACGACCAGCATGGCATCAA
CGACAAGTGGCCATATTCCCAGCAGCGCTACTGCTGGCAGCATATCTGAACGCACCATGTCCATGGCATCGACGCTGGCA
CCATCGATTGCAGCGCGGTCTGAAAACGGCGAGCGCCCGCCGACAGCCAAGATTCGTCCGCCTCTTGTGTACCCGGCACT
GTTGTCTCGCGTTGCCGAAGTCTTCCGGGAGAAGATTGTCATTGGCGACCGCACCAAGAACGAGCTCTCGTACAAGAATG
CATTTAGCGGTGCCGAAGCTGTCGACGTTTTGTCCTTTATTATTCGCACGACCGACCGCAACTTAGCTCTGCTTCTGGGC
CGCGCCCTCGACGCGCAGAAGTTTTTCCACGATGTCACATACGAACACCGGCTCAGAGACTCGACAAATGAGATGTACCA
GTTCCGTGAAAACCTCGACGATATGGCCAACGAGGAGTCCGGTTCTAGTCAGAATACAAGCAGCAGCGTCAACGGTGTGT
TTGTGCTGCTGTCAGAGTGCTATTCGCCGACGTGTACGCGCGATCAGCTCTGTTATTCCATCGCGTGCCCGCGACGCCTG
GAGCAAGTATCGCGGCTCAACCTCAAGATGGGACCTGGACTGCAGGGTGCAGAGGGAACCGGGGCCATGGTCGGCGAAGA
CGACGCGGATGTCACGGACGAGCAGAAGCTCTGGATCAACTCGGTGCCCAAAGAGGTGGCAGACAGCACCAGCGACCGAG
AGAAGAAGCGACAGGAGGTTATATCCGAGATCTTCTACACAGAACGCGACTTCGTCAAGGACCTGGACTATCTGCGCGAC
TTCTGGATTCTGCCACTGCGGGCATCCACGTCGCCTATCCCGGCTGCCCGCCGCATGCATGTTGTCAGCACCATCTTCAG
CAACATCATCGACCCGCCAGCGATCCGGGCAGTCAGCGCCCGATTCGCCAAGTCGCTCACGGAGCGCCAGCAGAAGAGCC
CGGTGGTGCACCACGTGGGCGATATATTCCTAGAGTTTGCGCCGCTGTTCGAGCCTTTCATCCGATACGGTTCGCGGCAG
CTGGAGGCCAAGTACGAGTTTGAGAACGAGCGCAGCAGCAACCCGGCCTTTAGCCGGTTTGTGGACGAGATTGAGCGGCG
GCGAGAATCGCGTAAGCTGGAGCTCAACGGTTACCTGACGAAGCCGACGACCCGTCTAGCCCGTTACCCGCTGCTGCTTG
AAAATGTACTCAAGTATACGGAGGCGGACAATCCGGACCTGGTGGACATCCCACGCGTTTTGGTCATCATCCGCGATCTG
CTCAGCCGGGTCAATGCGGAGTCGGGCAAGGCCGAGAACCGGTTTAACCTGCGGCGCCTAGACGAGCAGCTGGAGTTCCG
GCCCAACGAGAAGGTGGACTTGAAGCTGCGGGAGGCCAACCGCGAGCTGGTGTTTAAGAGCCAGCTGAAGAAGTCGCCTG
CCGATCCGCCAGACATCGTGGCGTACCTGCTGGATCACGCGGTGCTGCTTGTACGGACGAAGCAGGTGGGCAAGGTGGAG
AAGCTCAAGGCGTACCGGCGGCCCATCCCGCTGGAGCTGCTCGCGATCAAGGAGATGGACGAGGTGATACCGAAGCAAGG
AGCGGTCAAGCGGTCGTCAAGCAGCATCCTGCCGCTGCGGGCAGGCAACTCGGAAGCAAAGAAGGGCGACGGCTGGCCCA
TTACCTTCCGCCATCTCGGCAAGGCTGGATATGAGCTGACGCTTTATGCGTCGAACCAGGCTGCGCGCCAGAAGTGGCTC
GAGTTTATCGACACGGCCCAGCAGCGGCTGCGTGCCCGTGCGGACTTCCTCAACACGACGGTGATCCCGACCAACTTCAT
GACGGCCATCAACAAGGTCAACTGCGCGGCACCTTATGGTAAGGCGTGCCGGACGGATGTGTGGGCCGTATGGACATATG
CTAACGATGTGATGCAGACGGTGGGCGGAAGCTCATCTACGGGACGGACAACGGGATCTGGGTGGCGGACCGGAAGTCGC
GCGAGCCATCGATGCCGCGGCGGGTTGTGGAAACGCAGTCGGTCACACAGGTGGACGTGCTGGAAGAGTACCAGCTGCTG
CTGGTGCTGTCGAACCGGACGCTGTTGTCGTTCCCGCTGGCGGCACTGGCAGCGCTGGGACCGGACGATCCGACGCTGGC
GAAGCGGCCGAAGAAAATCCAAAGTCACTGCAGCTTCTTCAAGACAGGCATCTGCCTGGGTAACCATCTGGTGTGTTGCG
TCAAGTCGTCGGCGCTCTCGACGACGGTCAAGGTGTACCAGCCGAACGACACGATGGCCAAGGCAAAGGGCAAGAAGGGC
TTTGGCAAGATGTTCAACGCGGGCCAGGACGAGTTGAAGCCGTTCAAGGAGTTTTACATCCCGACAGAGTCGACGTCGAT
CCACTTCCTCAAGTCGAGCCTGTGTGTGGCGTCGGCGCGCGGATTCGAGGTGGTGTCGCTGATGACGCTGGAGACGCAAT
CGCTGCTCGACCAAGCGGACACGTCGCTGGACTTTGTGGCGCGCAAGGAAAATGTGCGGCCGATCCACATCGAGCGGCTC
AACGGTGAATTCCTGCTCAACTACTCAGAGTTCTCCTTCTTTGTCAACCGGAACGGATGGCGGGCGCGGCCAGATTGGCA
GATCGACTGGGAGGGCAACCCACAGAGCTTTGCGCTGTCATACCCGTGGATCCTCGCGTTTGAGCCCAACTTTATCGAGC
TGCGGCACATTGAGACCAAGGCAGTGCACATTGTTCCGCACAAGAACATCCGGATGCTCCACTGCAGCACGCACGAAGTG
AGTTTTGGGGATTCTTTTTTTTTTGTGTGCTTATGACGTTGCATTGTACATCATACTGACCCTACAGATCATCTTCGCGT
ATGAGGATGAGCGTGGAGAAGAAGTGGTCGAGGCGCTGGACTTCTGGAAGAGCCAGCGGAAGTCGGAATTGCCGGGCATC
GGGGAGACTTTCGAGACGACGCGTGTTAGCAGCAATCCGCCGCAGCTGACGCTGTCACGCCTATCCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62