GenePrediction:GLEAN_5153 Details

Name: GLEAN_5153
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1506032..1504345 (- strand)
Length: 1688
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1506032..1505592 (- strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_97:1505524..1505441 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_97:1505378..1504438 (- strand)
Length: 941
Type: CDS
Source: GLEAN
Position: GCSC_97:1504387..1504345 (- strand)
Length: 43
>GLEAN_5153 class=GenePrediction position=GCSC_97:1506032..1504345 (- strand)
ATGCACTGCAAAGATTCGCTCTCATCTGGCTCTTCACTGTCTGAGACGACAACGTCCGACAGCAGGATAGACTCAAAGAC
TCCGGCAGTCTCGACTACTGTGCTGCTTTCCCAGACCGTCACAGCTGTCGCTGCTTCCGGGCCGTCGCCGATTGCGCGTG
CGGACCCCATCGCTGTCTCGCACTCCAGTGCCGCTGCCCGGGGCTGGTCTTGGTTCCGCACCGAGCTTTTCTGCGGCCTG
GCCGTCTTGGCGCCCGTCGCCATCGTCGTGGGCGCGCTGCATTGGCCATCGCGGGTCGTCTTTGCGCTGAGCGCACTCGG
CCTGGCCGGCCTCGAGGTGCTCGTCAGCACGGCGCTGGAGCGCATGTGTCTGGCACATGCTGACCGGAACTTGCTGGCAG
CCGCCTGTCTCGAGATACTCCCCAGCATCTTTCCCACAATGGTGCGTTTGTACTGAAAGCTGCTCACGAGCTCGCCAGAA
TGATCAGGCTGACCCGCGAGCTCTGCAGATCGGCATCGTGTCGCTCGTGTCCGACGAGATCAATGTTGCCAAGTCGTTTG
TCATTGGTAACGTCCTGAACAACATTTTGCTAGTGAGTCGCGACCTCAACAAGACTGCCGTTTGTCGAGATTGCTGACAT
ACCGCCTCTCTCAGGGCACCGGACTCTCCCTCTTCCTCGGCGGCTTCAAGCCCGACAATGAGGGCTATGCTCAGCACGTC
AGCAAGACGGCCTTTGAGCTGGTCAAGCTCACGCTGATCTCGACCTCGCCCGTCATCATGGCCTGGGCGATGATCTACGT
CATGACGTCACAGACAGAGCTGGCGGTCCTCAACAGCGACGGTGTCGTCGTGAGCATCGATGCCGTTCAGGCTGATATCA
ACACGGAGGTCAGCCCCGCCACAGCGGCCGCCATCCGCGGGATCTCGCACGGGACCGCGGTCATCCTGCTGGTCGTCTAC
GTGGTCTGGGTCCTATTCCGCCGCGTGACGCACCGTGACTATTTCGCCGACGACGATCGCAGCCGTCAGGCCGCAGCGAC
GATTGTGCAGCAGCAACGGGGTGTGTGGCCGCTGCTACGGAAGGAGGCTGAGGGTAACACACAGACGACGACAGATGGTG
AGCAGTCACGGAAGTCACGGCTGTCTGCAGCAAATATCACGCAGACTGTCGCTTTTGCTGCTGCCTTTGCAATGGCCGTA
TTTTGCAGCCACTACCTCGTAACCAGCATCGATCCGTTGGTCGAGGAGTCGGGACGGACCGGCTCAGCGGCCGCCTCGTC
TGTGCGCCGCCATTTTGTAGCCAGCATCCTGCTGCCGCTCATCGTCAACCTCTACAGCGATGTGCGGGCAGCCGAGCTGG
CCAGCTGCGGCGGCCGTGACATCAGCCTGGCCGTGCATCTGACGTACGGCGCCGGCGCCAGCTCCATCCTTTTGACGCTG
CCGGTTTTGGTGGTCATCGGTTGGACTGCCGGCCACACGCTGCTGCTCGACTTCAGTGCCTTTGATGTGTCCATCCTGGC
TGGCGGCGTGTGGGCGACGTCCATCCTGACGACCAACCAGGTGGACTACTTTCGCGGTTTTGTCTTTCTGTGCCTGTAAG
GACTCCTTTGTCATCCAGATTACGTTCCTTCTAACTCTCGACCAGATACGGAATCCTGGCGCTGGCCGTCTTCTTATTCA
AAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62