GenePrediction:GLEAN_5156 Details

Name: GLEAN_5156
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1492298..1491579 (- strand)
Length: 720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1492298..1492248 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_97:1492103..1491945 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_97:1491782..1491579 (- strand)
Length: 204
>GLEAN_5156 class=GenePrediction position=GCSC_97:1492298..1491579 (- strand)
ATGCAGCCTAACCTGTTCGGGCGAGAAGGTCAGTGGATCAGGGCATACTATGTAAGTTACTGGAGACGGCCGTTTTGGCG
CCGAGCAGGACCACAGGTAAGATAGAGGGCGACACGGACTGCGGGATAGACTATCCGAGTAGAGAGCAGCGTGCACAGAA
GCACCCAACAATACGACTACGGACTCGGATGACAGCTCGTCCAGTCACGGAGCAAACCGCGTGCCTGGTGGGAGCCTCGC
CCGTTCAGCCGTAGCCAGCAGCCGGTTGTAGGCGAGAATAAACGCGACGATGTAAAACTGGAAATGCCACCGAAGGCCAG
CTCATTTCACGGCCATGCAACTAGCGAGCGAATGGTGAGGCATCTGCTGGACAGAAAGCGGTCAGACCAATCAGGACAGT
GCCCACAGGGGTGTCATGTGGCTGATGCAGCGGTGCAGCCTCTAAAAGAGGGGGTTAAAAAAGTCTAAAGGCACGAATTC
TGTGCCTCTGACGAATCCGACAGGGCTTTGTTTTAGCGGCTTTCGGGCGGCGTACTTTACGAGGGCAGGCTCTTGCAAAC
GCTATGGTCAGCGTCCGGTGCTCAGCGCTGGGCGTCCGGTGGCGACTGCCTGACCTACAAGGCTCCAAGGGATTTCGAGC
TGGCCGTTGCAAAGGGGAAAAAAGGGCAGGAAGAAAAGAGGGCAGGTGCAACTGCCACGTTGTGTGGCACTACTCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62