GenePrediction:GLEAN_5157 Details

Name: GLEAN_5157
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1491106..1486256 (- strand)
Length: 4851
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1491106..1490941 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_97:1490876..1488250 (- strand)
Length: 2627
Type: CDS
Source: GLEAN
Position: GCSC_97:1488180..1488152 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_97:1487420..1486256 (- strand)
Length: 1165
>GLEAN_5157 class=GenePrediction position=GCSC_97:1491106..1486256 (- strand)
ATGAGCTCTGCACCAGACGCACAGCCGGTGCAGGAGACTTCTTCCGCTTCTGCTTCTGCGCTGCGCCAGCGCCACGGAGC
CACTTCAGAACCAGCCGAGGCGGCTGTCAGGTCAGATGATATCCTGAAGCCCAAAAAGACGTACGGCCGGACACCGGATG
GCACAGGTAAGCCCGCGCTCCCGTCTATATCTGGCTGTTCAACCGTTGAACGTCTCTCTCTCGCCTGCAGTCTTCACTGT
CCCGACGACCCATGACATGGTGTCGCAGCTGCTGGACCCCCGCCAGCCAAAGAATCTCTCGGACGTGACGGTGCTGGTCA
TCATCGGCCTGCACATCCTGGCGGCCTACCTGCTGCCGGCGGGCCTGAAGCGTCCCGTGTTCGCGGCCATCTTCATCTTC
TGGCGGGCGTCGTACAACATTGGCATCGGCAGCCTGCTGACGGTGCAGTCCAAGTACCGGCTGCTCGTGCAGTGGGCCAA
GCGGTGGCGACTGTTCGAGAACCCGGCCACGGGCAAGAACCCCCGGCCGTGGCTGTACCGGCTCTTGAAGCAGGAGCTCG
AGACCAAGATCCCGGAGGACTATACGTTTGAGAAGGCACCCGTCGAGTACAACACCTGGCTCGTCTTCCGGCGGGTCGTC
GACCTGATCCTGATGTGTGACTTTGTGTCTTACTGCCTGTTTGCCGTCGTGTGCGGCCACCGACCCGAGGGCGAGAGCCT
GACCATGGCTGTGGCCCGCTGGGGTGCCGGCATCGCCTTGGTCGGCTTCAATCTCTGGGTCAAGCTGGACGCCCACCGGG
TCGTCAAGGACTTTGCCTGGTACTGGGGCGACTTTTTCTACCTCATCGACCAGGAGCTGACCTTTGACGGCGTCTTCGAG
ATGGCTCCTCATCCCATGTACTCCATCGGCTATGCCGGCTACTACGGCATCTCCATGATGGCCGCCAGCTACGACGTGCT
GTTCATCTCCATTGCCGCCCACCTGACCCAGCTCATCTTCCTGGCCGTGGTTGAGAACCCGCACATTGAGAAGACGTACA
ACCCGCCACAGCCGCGTGCTCGCGCCGACTCGGACTTCATCGGAGAGCTGCAGCAGCAGCAGCAACAACAGCAACAGGAG
CAGCTGGCCACTGCTGACGAACCCCTGGCAGCTGTACACGGCCTGTGGGGTATTGCCAACTTCGACATGTTCCGCATCAC
GGACTACTCCGTCATCCTGCTGGGCGCCTACGTGCTGACGCTGGCATTTGTCACGCCGGCCACGCCGCTCTGGCAGGGCC
TCTTCTTCGCGCATGCCGTGGCCTGGCGTCTGTGGTACAACATCGGCCTGGGCGCCATCCTGCGTGGACAGTCGAGCGAG
AAGCAGCTCACCCGGCACTTTCTCAAGTTCGGCGACACGGCTGGCGAGGCCTGGCGCCAGTGGAAGGGCATGTACCACGT
CAGCATGGCCTTGTGCCACGTGTCTTTTGTGGCGGCCTGCTGGAAGATGTACTCGCCGCCGGCCGACTGGCACTATGGCT
GGGCGATTCTGAAGCACGTTTTGGGCAGCTGCCTGGTGGCACTCCAAATGTGGACGGCCGTCAGCATCTACGACGAGCTC
GGCGAGTTCGGATGGTTCTACGGCGACTTCTTCTTCGATAGCACCGGCAAGCTGACGTACAAGTCCATCTATCGCTACCT
GAACAACCCGGAGCGCGTGATCGGCACGGCCGGGCTCTGGGGCGCGGCGCTGATCACCTGGAGCCGGTCGATCTTCGTGC
TGGCCATGATTAGTCAGCTTTTGATGCTAGCCTTCCTCGAGTACGTGGAGAAGCCGCACATGCAGAAGATCTACGGACGC
AAGCTACGGGGCGAGGCTGGCCTGACCAAGTTCATCCGCAAGTCGCTGCCGCCCCCAGTCAAGGAGTGGCAGCAGAGCGT
CGACCGGGTGCTGGACGAGACGCGCCACTTTGTCGAGGAGTTTGTCGACGCCGCACGGCCGAAGCTGGCTGCCGGCGTGT
CTACCATGGTCCGCGACACGACCGCGCTCTTCAACAAGTATCCGGCGCGCCTGACGACAACCCGTCTATCGCCCGACCTG
GCCGGCTTCGATCCCAAGTACTACAGCCTCTCGGTCGAGGGCGCCAACGGCAGCGATGGCACCAAGCCGGTGGTGCTGCC
GTTTGGCGCACCCATCCGGGTGCGGTGGACGGCGCCGGTGCAGCACAAGAAGAAAGACTGGGTGGGCCTATACATGGTGA
CGGACAACCGGTCACGCGAGGTGACGGAGGTGCCGTCGCTGGGCCGCTGGGTACCGACGTGTCCGGGAGTCTACGACACG
GCCATTGACCGGGGCATCGTGTCGTCGGACGAGCCGCTGAAGGAGAGTGGCCGCGAAGAAGACGGTGCAGACGAGCAGGC
GCCGGCACGCGTCGGTGGCGAGATGGTCTTTGAGGGCGACCAGCTCTGGTGGACCCAGGGCGTGTTTGAGTTCCGCTACC
ACCACGACGGCAACCACAGCGTGATGGCGATCTCGCAGCCGTTTGAGGTGCGCATCGACCGATTCGACAACGACGAGGAC
GTCGGCAGCAGCAGTGCCACCAGCATCACGAGCGACAAGGACGGCCTGTTTGAGCGGGCTGTCGAGGCGGCGCTGCTGCC
GATGGTGCAGAACTGCTTCGACCGCGACCCCGACATTGCGCCGACGACGGCCGACGAGCTGTTTGGCGAGCATGTGGAGC
GCGACTCCAAGTACGCCCGCCGCGTCGTCTATGCCATCCAGCACATGTTCGGCATCGAGTTTGCGCCGGCTGTGGTGCCG
GCCGATGCCACTGTGCGCAAGCTGGCATACCGTATATGCAATGCCAAGCAGGTTCTTGTGAGTGTGGCCGGGAGGAAAGA
AGGATTCGGAGGACTCGGCTGACTGTTTGACATAGGCACCATACAGCATGTCGCCCTCGCGGCAGTGATGGGAGGGTAGA
GTAGTGGGGAGTCCTCTTCCCTTTCTCGTCCTCTCTCTCTTTCCCGTTCCTTTCTGGCTTGGTGTCGTCGGAGATACCTA
AAGAATCATTTTCTAATAGTGCCCTCATACCGTAGAGGTCAGAGGGTGGATGTGGAAAGTTAACAAAATTATGGAGTAGA
AGAATGAGTTATGTCGAGTCCGTCACATTGGCATCATAATAGTAGGCAGTTGTAAATACTCCGTACTATGTATGGAGTAC
TCCACACAAGCCAGTGGACACGTGCGGGACTAAAAATACGCCATGTGGATATGTCAGCATCCACCGCTTACTAATACGGG
TCAGGAGCTGCTTAAATTACTCCGTACTTCCTTTCCCAGCCCCACGAATTTCGAACTTTGACTTCTTCATCACCTGCGTT
TCGCATGCAGCCGCGATAAAAAAAAAACCAAACACGTTCAAGGAGCGAGCACCTCGCGCTCTTGGCCAGACTGCCGGCTT
CTACCCATCGAACGAGAGTGATCTCCTTTGCTGGAAGAATCGGGGCCTTGAGAAGGGACCTTGCTTTGACTTGCAGCCTT
GAGTTGGGGGATAAGCAGGCCGCCTGTCAGCGAATCTGGCTCCTTTTTCGTCGTCTGTTTTTCCGATATTATCGACCGGG
CGAGCGACGCGAATGCACGGTGCTGCGCATGTGTCGCTGTGAGTGTTCCTGTCCCCTCGCCTGTGGTACTGATGTGAATG
AAGTAGCGGGACGGTCCAGCCAGACGTGTTGGCCCAAGTGACGGCCATGTCAGATTGCATCGAATTCCGAGCGCCGGCCG
TTGTCGAATGGGAGAGCGAGGGCGAGCGGATATGTCTGGCGGATGCGGATCCGCGGAGTGCGCGGGTGACGTTTGAGGGT
CGTCTCCACGAGGACGCGACCGCGTGCAGCTTCTTCCAGCTGCACATTCCCGTGCGTCTGCGAGGTGTGACGCGCGACAC
GACGATCCTGATGCCGCTGTACCCGGATGCAATCGACTCGTTGGAGCCGGAGCGATTTCCAGCGCCGGCGCCGGCGGCCG
TCGACAAGAAGCTGCGCGGCAGCTGTGTGTGTCTGCGGTTCCGGCTGCGACGCCCAATACCCATCATCGTGCCGATAACC
GCAGCCATGCCACTGCGGCCGTTTCGTCGTCCGACCGGCGACGTGCTCGACCGGCTGCGCTCGCTTGTCCACGTCACCGC
GCTGGACGTGTACGTGCCCGATCTCGAGCTGTCGAGCGCCAAGCTGCAGGCCATTCAGACGCGTCTGGCCGCACTCCAGA
CAGTCCAGCGGGCATCATCCCGGACGCGGTCCCGGCCACCATCACACGACCTGCGTTGCCTCTTTGACGGCACCGGTGGC
AAGATTGTCGACCGCCTCGACGACAGCCCACCGGCCTACGACCAGATCGGACCGCCGCCACCGCTGGCCCCAATCGTCGA
GCCCGATCGGAAGCCAGTCCCCCCGTCCGACCACAAGGCCGAACTCGAGCCAGCAGGCTACAGGAAGCGTCGCCGTCGCG
AGCGCGACTCGCCACCCCCTGACGACATCGACAGCCGGCTCGCTGCCATCTGGGCCGAGCTGCGCCGGAAAGACGACCGG
ATCGAGCAGCTCGAGGCCCGGGTGCAGCAGCTAGAACACGACCGAGAGGAGGGGGCGGAAGAGACGGCGACACTCCGTCG
CGAGCTCGACAAGGCCGTGGCCGCCAACGAAGAGCTCGAGGGCCAGCTGCTCTTGACGGGCGAGAGACTCGACGGCTTGG
TCGACGAGGTGGCGTACATTCAGGAAAACGGGCTAGACAGCGAGGTGGAAGACCGGATCGTCGAGACGGTCACCGACTGT
GTTTTTGAACAGATCTCTGAGAATGCCACCGTTACATTTACAAGAACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62