GenePrediction:GLEAN_5158 Details

Name: GLEAN_5158
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1477444..1476474 (- strand)
Length: 971
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1477444..1477262 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_97:1477209..1477048 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_97:1476976..1476594 (- strand)
Length: 383
Type: CDS
Source: GLEAN
Position: GCSC_97:1476516..1476474 (- strand)
Length: 43
>GLEAN_5158 class=GenePrediction position=GCSC_97:1477444..1476474 (- strand)
ATGAGCAAAGTCATCATCGTCACCGGTGCCAGCCGTGGCATCGGCCTCTGTATCGCTCAGCACTTGCTGGCCCACAAGCA
TAACGTCGTCCTCGTTGCCCGGACGGCTGCGCCGCTGGCCGCCCTCAAGACCCAATTCCCAGACCAGGTCGAGTATTCTA
CCGTGGACTTGACCGACTTTACTGTACGTGAGGCCAAATACGCAGCACAGGCCAGAACACTGACTTGCGCCTTAGACAGC
CCCTCTGGTGGTCGACCTCGCCATCAAGACCTTTGGTCGTCTGGACGGACTCATTGCTAATCATGGAGCTCTCTCGCCTC
TGGCCCATGTTGCAGACGCAAGCATCGACGAGTGGAAGCGCCTCTACGACATAAACTTCTTTAGTGTGCTGGCCTTGGTA
AGAGCCGACGCTCGCTAAGCCGAGCCGAGCTAAGGCGCCCTCTTTATTGACAACATCTTGTCCTTTAGGCAAAGGCAGCT
ATTCCCAAGCTGCGCCAGTCCCAGGGCCGCATTGTGGTCACTTCATCCGGAGCAGCCGTCAATGCATATACCGCCTGGGG
CGCCTACGGGAGCTCCAAGGCCGCCGTGAACTCGCTGGTGCAGCACCTCGCCGTCGAAGAGCCCACCATTGCCTCCATTG
CCGTCGGTCCTGGCCGTGTCGATACAGACATGCAGAAAGAGTTGCGTGAAGACGGCGCCACAACCATGGCACCCAAGGAC
TACGCCGGCTTTGTGAGCGCCTTCGAAGAGGGCAGGCTCAACCCGCCCGAGAAGCCAGCTGAGGTCATCGCCAAACTGTC
TGTCGACCTTACACTCGAGCACAGTGGACGATATGTCAAGTACGAGCATACGTTGCCCCCCCTTGTCTTATCACGCGTAC
CACCTACTAGACTTACGTTGCTAATCGTCGACCTTACTGGCTAATCAGTTGGAACATCCCGGACATGGCACCGTACCACT
GGTCCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62