GenePrediction:GLEAN_515 Details

Name: GLEAN_515
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:303576..306328 (+ strand)
Length: 2753
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:303576..304441 (+ strand)
Length: 866
Type: CDS
Source: GLEAN
Position: GCSC_97:304492..305000 (+ strand)
Length: 509
Type: CDS
Source: GLEAN
Position: GCSC_97:305264..305284 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_97:305520..306207 (+ strand)
Length: 688
Type: CDS
Source: GLEAN
Position: GCSC_97:306268..306328 (+ strand)
Length: 61
>GLEAN_515 class=GenePrediction position=GCSC_97:303576..306328 (+ strand)
ATGTTGACACGATCGACCAATGCCTCTCCCTGCATCCCCGGATTCCACTATGCACCCACTCGCTCCCCGCGCCACTCGCC
TTCCCGCATCTCGGCCGCTGGTGCACGGCGACCTTCGCCTTCCTCCTCGCCGGCAGTCCTCGCCGACGCCGTCCCTGCTG
TGAGCTCGCCGCTCTCCCACCCGCTCTCTGCTGCCGCTACGGTACTTGCTGCCCCCTCTGCCAGCATGTCGCCCGCCTAT
GCGTCCGCCGATGCTGCCACGCAGTACTCGCCTATGGAGCCGTTCGATTACGCCGCCCATCCCCATCGTTACCCCCCGCA
GCCGTCGACCCCCTTGAACCCGCCTTCGATTCCGGGGCCGGCCCCGATGGAGCCAGGCGTCGAGCAGGGCGTCGAGCAAA
CACAACCAGACCAGCCGTCACAGACACCGTCACAGACACCGTCACAGACACCGTCACAGACACAGTCACATCCTCAGTCA
ACAACCTCAACAACCTCACCAGCAGTGGCAGACGGCCACCCCCCAGCAGCCGCGGCCATGGCACCACCACAACCACCGTC
ACAACAGCCACAACAGCAGCCACTGCAGACACCCTCTCCCAACAAGCGGCGCAGCTCGCAGAGCGCTACCCCTGGAGAGA
CGGCCGTCGACGGCATCGTGTCGCCTTCGTCCCTCGCCCGCAGTTCGCCCACACACTCCAAGCGCGTCAAGGCCGAGGCC
GAACCGGCCAAGATGCTGCCAGAACGCTACGAGCTGTGCGCCGTCGAGGACATGGTCGTGCTCATCGCAAACATGCTCGG
CGAGCTGATCGAGACCAACGACGCGCTGGCTCTCAAGGCCGGGCACCTGACCCGGTTCCACTCGAGGTAGTTCTCTTCTC
TTCTCTTCTTCCTTCTCTCTCCCTAACGCTCCGCAGAACGGCTCCAGGCATCTCCGTCCTGGACTACCTCAACCGGCTGG
CAAAACATGCCACACTGACACCACCCCTCCTCCTGTCCATGGTCTACTACATTGACCGCCTGTGCGCCATGTACCCCGAC
TTCACCATCAACACCCTGACGGTCCACCGCTTCCTCATCACGGCCGCCACTGTCGCCGCCAAGGGTCTGTCCGACTCGTT
CTGGAACAACTCGACGTATGCGCGCGTTGGTGGCGTCCGCGTGACCGAGCTCAAGATGCTGGAGCTCGAGTTCCTGTACC
GGCTCGAGTGGAAGATCGTGCCGAACCCAGAAGTCTTGGCCGCATACTACCGGCCGCTGGTAGAGCGGTGCTCAGGCTAC
GTTTTGCCGGCCGACACCACCGACTGGACCATGGACGTGACCGCGAACGCGTTCAACAACAACTCGTCCATCCCCGTCAA
TCGGGAAGACCGGGATCCGTCGAGCACCAGCCTGGTCGATAAAGACATGGTCATCTCCGGGTCGGGTCCGGCCAGGGACA
GCAATTTGTGAAGAGGAGAGAAGACGGACGAGAGCAAGAGGCGGAGGAGCACATTGGCGTATTACGGAAGTCACAGCATC
TGTCTGAGTCTTTTATTTGTTTATTTTTTGGGCGTGGGCACCAGCAGGACTTGGGGGAATCGTGCTTTCGAGCGGGTGAG
TGCTGGCAATAATAGTTGGAAGACGCATGTGGGAGGGACTCTTTTGAGGGGACAAGACATCAAAAACCAACTAGAAATAC
CACCATAGGGAACGGCGCCAGCAATGTGCGTAAGATAATACGGAGGCATGGAATATGAAGTACTTGATCTTATGTGCAGT
TACTAGTTCTGCTGGCCTTTAGTGGTGTTGGGGTAATTTACAGCGAGCGATGGCCGGCCCGTCGTCCTGCAGGCCAGCAG
AAGGACGCTAAGCGACAGCGCCTATGCGCGGAATAACCGAATCGAAACCGTGGCTTGACAACACGGCCGAAAAGCGTCAT
CTACGCCGATCTGTCATCTCGCAGAACCCCTCCCCTCGACCTTGGCCAGAGTGACACACGCCGTCGCAATCCCCTCTTCC
GACCAGTCGCCCATCATGCGATCGTCTCCCTTCGCTTCCTTCATCCTCCTCCTGGGCGCCGTCGCCGGTGCAGCTGCAGC
CCAGGCTGACGCCGACGTGGACGTGTTGGATGCTGCCGCTGCCGCACCAGGCACGCAGACGGCCGCCATCTACGTCCAGC
CGGTTGCGCCGCTGTCGTCGGCGCTGGCCCAGCCGTCGCTGCTGGCCGAGATCCGCTTTGATGCTGGCGGCCTGGCCGAG
GTGGCCAGCTACGAGGCCCCAGACGCACTCGAGCAGGACAAGCAGGACAAGCAAGACACCACGTTGCTCTACCGCATCGG
CCTCTACGATCCGGTCGCCAACCGCTGGCTCTCGGCCACGTCCGTCACCGCCGCCTCCAACTTTGCCAAGGGCTACCAGC
CGCACTTTGTCCTGACCGTGGCCAAGAGCGGCAGCGAAAGCAAGAACAGCTTCCCGATCGCGGCGGCCGTTCGCGGACTG
CCCATCGACGCCGGTGCCACGCGCGACTTTGGCCCGCAGGCGACGGTGGTGCAGGTGGGCGCCGGCAAGACGCCGGCGCT
GAACCGGCCGGTGGTCCTGAGCCCGGAGGGCAAGAAGCTGGAGGAGCCGGAAGAAAAGACCTTTCTGCAAAAGTGAGCGC
ACAGACACCCTCTCGCCCTCTCTCTCGCCTAGGCGCTAACACATGGCTTCAGGTACTGGTGGATGATCGCGATCGGCGTC
TTGGTGCTGACGATGGGCGGCGGCGACAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62