GenePrediction:GLEAN_5161 Details

Name: GLEAN_5161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1463840..1462822 (- strand)
Length: 1019
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1463840..1463519 (- strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_97:1463440..1463214 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_97:1463148..1462822 (- strand)
Length: 327
>GLEAN_5161 class=GenePrediction position=GCSC_97:1463840..1462822 (- strand)
ATGGCCGGCACCGTCCCTCCACAGAGATCGCGGCCACCGCGGCCGCAGCAAAGAAAGAGGAAGTGGAAGCCACCGGTGGA
AGAGGGAGCGGCGACCAAGCCGACGGGCGAGACACCGGCTGGCGACAAGGCTGCTCGGAAGCGACAGAAGAAGAAGCGCA
ATGCCACCGACGCCGACGACGGCGACATGGACTTTGATCTCAGCATCAACCGTGCTGTAGCGCGAATGGACAGCAACCTG
CTGGCGAATTACGTGGCCCGACAGACGCTGCGGTTCGGCAAAGATCTGAGCCCGGTCGAGCTGGCCGATCTGACACTGGA
TGGTAGGTGGCAGTCAGCCGTTTCCCTGTCTAGTTTTTCTCTAGTGTCCGTCTCGATCTGATTTGTGTTTTCTTCCCCAG
CCAAGCCGATCCTCGATACGTCGTCGTACGACAAGGACCGCACAGTCGATAACCTGCCCCATTTCCTCGAGACCTTCTGT
GATGGTGGCCAGAAGCACCTGTCCCAAGCGTCCAAGGACAAGGGCGCACCTCACACGATCATCGTCACAGGAGCCGGGAT
CCGGGCGGTCGACTTGGTGCGGGCAGTCCGCTCCTTTCAGACCGCTAACAGCACGGTGTCGAAGCTGGTGAGCGAGCAGT
CCTTCTGGCCTCCCCGGAACAGAGCCTGTACTGACTTTTCTCGCCTTCTCAGTTTGCGAAGCACATCAAGCTGGCCGAGG
CCGTCTCGTTCCTCCAGAGCCACCGCACAGGCATCGCCGTCGGCACGCCCGCCCGACTCATCGACCTGCTTGACAGCGGT
GCTCTCTCTTTGACCCATTTGAAGCGCATCGTCGTCGACGCGTCGCACATCGACCAGAAGAAACGCGGCGTTCTCGATAT
GCAGGACACGGCACTGCCGGTTGTGCGCTGGCTGGCGCGCCCCGAGCTGCGGGCGCGTTATGGCGGCAACGAGGAAGACA
CCCCAACTGACAGCAAAGATGACAAGGCGGCCCAGCCACTATCTATTCTGTTTTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62