GenePrediction:GLEAN_5162 Details

Name: GLEAN_5162
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1458069..1456180 (- strand)
Length: 1890
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1458069..1457171 (- strand)
Length: 899
Type: CDS
Source: GLEAN
Position: GCSC_97:1457113..1456466 (- strand)
Length: 648
Type: CDS
Source: GLEAN
Position: GCSC_97:1456366..1456180 (- strand)
Length: 187
>GLEAN_5162 class=GenePrediction position=GCSC_97:1458069..1456180 (- strand)
ATGAACACGTCTACGCCGGGCCGACCGTTGACGGCTGCCAGGACGCCGGCTACGAGCAGCCGCGGACGGCGAGGCTCTCA
GGGCTACAATGCGTCGGGAACGTCGGTGCGCACGCCGACGATGACGATGACGATGGGAAGCGCAGAGAGCAATGCTGCAG
CTGCTGGGCGGCGGACGCCGGGCACGGGCCAACAGTTGCAGGCGTCGGCAGCGCGGACACCGCACGCGCGAGCGGCTCTG
CTGGCGCTAGATACGCGGCGGGCAGCCATGTTTACGCCGGGTGGCCGCCAGAGCCGTCGAAAGAGCGGCCGATATCTGCG
CGAGTCGCCGCGCGATCTGCTGCGCAACCTCAGCCGGCGGCTGGCCCCAATATCCCAGCCGGTGGCCACGTCATCGTCGC
CGGCCTTTAGCAGCAGCGGCGGCAGCTCCGGCCCGAAGAGCCGCTTGAGCAGTCTGAGCAGTGTCCTGGAAGACCGGGTG
GGCAACTTCTCAGTGACCGGGATCTATGACGACGATGACGATGATGATGATGCCGACTCCCTCCCGCTCGATCGCCCGCG
CATGTCGCTCCCTATCGAGGACGACGACAACGACGACGACCTGCGGCCGCACCGGTCGCAAATCCTGGACGACGAGGAGA
ACTTTACGATGCGGTCAATCGAGCTCGCCCGCCGCACGGCTAACCTCGAGCAGCTGCAACAGGCCCGGCGCTTCTCTAGG
GGCAGCCTGGGTCGCAGCAGCATCGGAAGCCTGGGCATGAGCGACTACATCGACGGCTTCATCGGCAGCGCTGACGGCGA
CGATGACCGAGACGAGCGTCTGCAGTCGGCCTTTTTTGCGGACGGGGCGTTTGACAATCTGGCCGTCGAGCAGCCGGGCG
AGGACATTACGTTTGAACGGTACGTGGGACTGTCTGGGTGCGTCGCTTCCTGCAGTGTCTAATGCATGTCGTTCAGACTG
GACTCGGAGAGCGGACAGCAGATGGACGCCTTTGATGGTCGCGAGAGCGGCTTTGGGGTCATTGATGTGCCACTAAATGG
AGACGAAACGACCTTTCTGTTGGGCCCGCAAGGTGGTGCCGATCAGCCGATGGCAGACGAAACTGCAGGACCGGCCTATT
CGGACGGTGGAGACGACGGAGGACCGGCAGATGCCGACGTGGGTACTCCCTTTGATGACTACGGCGCTGGAGACGACAAT
GGCGGAGGATGGCCGGACTCGCCGGAGATCGATATCGAGGAAGAGGACGCTGGGGAGGATGCAGCGGTCACGACTGCTCT
TGCTTCCATAGAAGCAGCCTCCCAGTCTAAGCTGCTCGCTCGCGATGCCCAGAACAAGGATGCACGAGCTATCAAACGGG
CCAGACTGTCACGACACGGAATCGAGTATCCGTCGCTGCCGGTGGGCGTGGTGAAGCGCATTGGCCAGATGTTTGCCCAG
GGCAGTGCAGCCGGCAAGACAAAGCTCAGCCCAGACACGGTGGCTGCCCTGACCACGGCCTCGGACTGGTTCTTTGAGCA
AGTTGGCGTCGACCTGGAGAGATACTCCAAGCATGCCGGCCGCAAGACAATCGACGAGAGCGACATGCTTCTATTGATGA
AGAGGTATGTGCGAGACGGAGGGCAGCTTTTTTGCTCGTGTCGAGGTATATGATACAAAATACAGGTATATATGATGGCT
AATATCGGTTGGGGGTGATATAGACAGCGACAAGTCAGCGCAACAACAACGCCCTTCTCGCTCGCCCAGCGCTATATGCC
GCGTGAGCTTCTGCAAGAGCTGCGCATGATACCAGAGGCACCCGTCGGCAAGAGTCGACAGAAGCGGCGGCCGCGGGTGT
CGTCGGCCGTCCGGAAGGCGGACACAGGGACGGACGAGAACGTGACTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62