GenePrediction:GLEAN_5163 Details

Name: GLEAN_5163
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1449060..1446169 (- strand)
Length: 2892
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1449060..1448659 (- strand)
Length: 402
Type: CDS
Source: GLEAN
Position: GCSC_97:1448574..1446169 (- strand)
Length: 2406
>GLEAN_5163 class=GenePrediction position=GCSC_97:1449060..1446169 (- strand)
ATGCCTATGTTCGAGGACAGACAGGATCTCGTCCCTGACGGCGAGCTGTCTCAAGAAGCTCGGAGATCTCAGCGGGCACT
GACTTCCTTGCAGTTAGCAGCTGCAGCAAGCCTGACTTCGAAACCCGCCCCCATACCCCCCTCTCTGCCTCCTAACACTC
TCTCCCGAAGGCTGTCTGAGGAGAGTATACGAACCGAACTCTGCGAAGGCCCCATACTCGACAGCCCTCCGCTCTCGTCC
CTGCCCTTCTCTGGTGCATCGCAGCTTTACGAACGGCGCCATCATGCGGAACAGCAGCAGGCGCAATACGCCACTTCTCC
AGGAAGGGATAGTTTGGTTCTGACGACGTCCGACCGAGCTGAGCTGATCGAGCGGCTCAAGCGAGGGGAAAGCCCTACAT
GGGTACCTAATCGACATGTAGGCCCTCTATTGCCTGTTCTTTTCTGCTCCCAAGCATTTTGTTGTTCTGACTGGTCAATT
TTTCAGCTTGAGCCTTTGCTCCATCGCGAAAAGTCCGCATCACCACCTCGAAAGTCGCGACCGTCCTCTGCCGGTACGCC
AACGCCGAGTTTGTTGTCTGCCGCCGAGATGAGGCCGGAAAAGGAAGCTCGCAGCCGCGAGTCAGAATCATCTGAGAGAT
TACAGGAGGGACTGAATATCGAGCGACCGCGTTCTGCTCTGCACAGTGGAGATTTCACGCACGACAAGGTCAGTCCTGGG
AAGGATATGGCGGGGGCAGGAACTGCTGCGAGGGGACCAAGTGATGCAGGCGGGCTGTCGAGCCGACCTTTCCACAGCAG
CAGTACATCTTGGATAGCTACTTCGCCGCCGCGACACTACAATCCGTTTACATATGAGGCGACGTCGCCACCCATGTCGT
CCTTGTCTGACATACACGCTTTTCGGACAGGCATGGCCTCGCTGTCGTCATCCCTGTCCTCAAGCTTTGCGTATAAGCCC
CCAACCAGTCCGTTGGTGCAGTCGGAGAGCAACAACGACGACGATGACGGGGCCCATATCGGCTTGCCTACAAGCAGAAA
TGACGGTGCTACAGACAGTGCAATGGCAGGTAGCCTGCGGACCAACTCACGACGGCATACCTTGGCTTCAGCTACCAATA
CGCAGTTTCGACACTCTGTTTCTTCTCACTTTGATGTGCTTTATCAACCGTCCCCCCCCCAAATGGCAGGAGAGAGAACG
ACGAGCACGCGACGGGAAGGTGCCTTTCCATACCAGGCGCACCAACCGCGAAGATCTCTTACCTCTACGGCACATATCTC
CCCTCAACAGCCGCTCGAGGGATCCATGCCACAAAGTCCTAGTTTTCTCCGACCACGGCGTGTCTCGTTTGCCGCCGACA
CGTCCTCTCTACAGCATGCGTCGATGGTTGGGTCCTACGAGGAAAGCATTCTTCGCGGCCGCATGTCGACAACACCATCG
AAGCCGCTTGATTTCCTTGCACAAATTGGGGTCCTCGGGCTGGGAGCCAAGTGCAAGCCAAATCTGCGGTGTCCGCCACA
CGTGACGCTCCGATTCTCGGCCGTCTTCTACAGCTACGCATCCACTCCTCATGGCCGTTCGAAGAGCGAAGACGGACCAA
GTCCTTATGTGGGAATGGTGGATTTGGAAAACGGGCTGCCAAGTCAGGAGGCCGAGCAACGTTCAACGCGAAAGCGAATG
CACAGCCGGGCCGCAGCACAGGAAAGACGGACGACGCGGTTGGGAGTCGGCATCGATGACGCTGCAGCTGACGAGATTCA
GAACGAGGACACTGTGATGGAAGGTACTCAAGTGGAGCCGACACCGACAGCAGGTGCACCGATCCCGACAGCATCAGCCA
CGCGAGCGCAGAAGCGGCGTCCGTTCTTGTGCAGAGCTCCTCCAGGGGGATCGTACAGGATTCCACCGCACGGCCAACTG
CAGATGATCATCAAGAACCAGAATAAGACGGCAGTGAAGCTCTTCCTAATACCGTATGACGTGACGGGAATGGAGCCCGG
GACGAAGACATTTATCAGACAACGCAGCTACTCGGCTGGCCCGATTGTGGACAACGTGCCGATGCTGGCTGAGCTGTCGT
TGTCGGAGCGGCCGATTCTGCGGTACCTGGTGCACCTGCACATCTGCTGCCCATCGCGCGGGCGATACTACTTGTATAAG
AGCATACGAGTTGTGTTTGCCAACCGGGTGCCTGACGGGAAGGAGAAGCTGCGGAACGAGCTGACGTTCCCAGAGCCACG
CTACTCGCCTTACAAGCCGGTGCGCGTGATGCATCCTCCGGTGGGAGGCAGTGGCAGCGGGCTGGGCAGTTTGGGAGGAG
GCCCAGGGGCCATGCTTGCGATGGAGAAGGCGTGCAGGCGGCGCAGTTCAGGACTGTCGTTTGGATCGGTTAGCGGCACA
GGCACATCCGAGGCGCCGGACGGCCAGTCGTCGCCGTCTCTCATGCCACTGCCGATTCCGATGGCCAATCCGATTGCTGG
GTGGAGATGCAACCAGCAAACGTCTGGATCGGCGTCGTTCAGTTTTTCAGAAAACTTGCCGGTCGATCCGATGCCTTTAG
GTCTGGGCATATCACAAGCGTCGTCTACATCAAGTCCGGTGACAGATCAGCAGTCGTCAAGCTACGCTGCTGGGGCGAAA
ATGGCAGGAGAGAGCGGGTCGGGAGACGAGGAGCAGGGGCGTGGACAGGTGTCGAGCGCGGTTGGACCGGCGCAGTTGAC
GTACAACAAGCTCAACAAAGGTGATGTTGGCTTTGGCGGAAATGCATTTGCGCCTATGGTGGATGGAAGCCCTGTAGCTG
AGGAAGGGCTTTTGTCACAGCGGCTTCGGTCGCTCGAGGTGCAGAGAAACCAAACGGCCGAGGAGCGAAGGCAGGATGCG
GCGAACAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62