GenePrediction:GLEAN_5164 Details

Name: GLEAN_5164
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1441631..1439580 (- strand)
Length: 2052
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1441631..1441438 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_97:1441380..1440196 (- strand)
Length: 1185
Type: CDS
Source: GLEAN
Position: GCSC_97:1440129..1439580 (- strand)
Length: 550
>GLEAN_5164 class=GenePrediction position=GCSC_97:1441631..1439580 (- strand)
ATGGACATTACCCAGTTTGTCGTCTCCTCGCGAGACAAGGTCGACCTGCCGACCGACTACAGCGGCTACCGGACCCGGCT
GGGACACCGCCTGCTCAAGTGCCGTCAGAAGCTGCACGTGGCCGCACGGCACCGGGGCAAGTACAACCACAAGTCGAGCA
CGGTGCAGCCAGAGCAGGTGGCCGAGGACGTGACGTAAGCCCTGCTTTTTTTGTCTGCTGTCTGCTGTCTGCTGTCTGTG
CTGACGTCCAGATATGCGCATCTGCTGATCCTGTCGGCCGAGCGGGCCCACGCCCAGGCCGTGGCCATGAAGACGGTCCA
GTCGGCCAACGGCAAGAACATCAACAACAGTGCTCGCTCGCACATTGTCTCTCGCTTCGACAAGGCCGCCAAGTATGCCG
AGGATCTGCTGGTCGTGCTGCAGGCCAACGCCAGCGGCGCCACGGCCGGCGACCGGCTCGAGGCCCGTGCCTATGCCGCG
TCGCTGCGGGGGGCTGCCGACCTGGAGCGTCGCAGCTGGCCGCGTAGCCTGGCGAGCTATGCGGCCGCCTGGGCCATCTA
CAGCGCGCTGGCCACAGCTGCAGCCACGGCCGGCCGTCCGGCCCAGGCCGACCTGTTCGGCGACCTCGTCGTCGAGAACG
AGCAGTGGGTGCGCTATGCGGCATACCAGCTAAAGAAGCCGCGGTCCACGCCGATCCCGATGCTTGTGCGCGAGGCTCTG
GAGACGTCGACCGACCTCGTGGCCACCATCCACCAGATCAGCCCGGTCGTGCTGCAGCCGGCCACGGCCACCGACGATGC
CGTGCTGGTTGACGCTGACAGCACCACGCCGCTCGTCGCCTCGACCCGCACGCTGACCTGGCGTTCGCGCGAGGTCCGCA
TCGAAGACGCCCCCATCGCGTCCGCCTGGGCCGCCCTCGATCTCGCCCAGGCTCGGCTGCGTGTCGTGCTCGTCGCCGGT
GCTGCTCGTTCGGCCGCGCCCATGTCGCCTGGCGAACAGGCTGCCGCCTACGACGACGTGCTCACCGCCAGCCAGGACGC
TGTCGACGCTACCAAGGCCGCCATCGACGACCTCCGCGCCGAGGGCCTCCCCCAGAGCGATCCTGCCGTCCAGCTGCTGT
ATGTCGCCCGCACGGCCGCCAACTACGAGATGATTAGCTACCGGATCGGCCGCAATCGCGTGCTGACTGGCCCCCATGAT
GGCGCCGTCGTCCAGCTCAACCACGCGGCCAAGAGCCGGAGCAAGAGCAAGAGCAAGACCCCCGCCGCCCGTCCCGAGGC
TCCCGGCCGCTTCCTCGCCCGGCTCAAGGAAAAGGTCGTCCTCTACGACGGCGTCCTGCAGAGCCTCGAGTCCGTCAAGG
AGCTGCCCGGCGTCGCCGCTGATACAGAGCTGTCCGCGCAGCTGGATGCTACCGCAAAGTACTTTACCGCGCTAAAGTGA
GTCTCTATTCCTGTTTTTCTCCTTTGTCCTTTGTCCTTCTTCATTCTCCCTTACACCCCTAGATCCCTCGCTGTCAGCCG
GTCCCACGACATCGCCGGCAACGCGGCCAACGCCCTGGCCCTCGCCAAGCACGGCCTCGACCAGTGCACAGAGGCTGCTC
CGACCCTGGCCAAGGTCGAGGAAACCGCATCGCCCTCGCCAGAGGCCCAGTCGCCCCTGCGCACTATCCATGTCGGCACT
GCCGACGTGCAGTTCCTGCTGGACCTGCTGCAGAACGAGGTGCAGCGCGGTCGCGCGCTCGTCAACATCGAGACGCTGCA
GCAAGCTGCCACAAAGGCGACCGCCACCACGACTACGCCCGCACTGGCCGAACAACTATCCGTCTACCCACAGCAGCCCG
TCGACCTGGCCAACATTGTCGCCTATCCGCCCCGCATCGAACCCGTGCCCGTCAAGCCCATCTTCCTCGATATCGCCTGG
AACTACATCGACTACCCCAGCAAGACGTCGGCTGCCGCCTCGGCCACGGCCGGCCAGACCGCCACGGGCGCACAGCAGAA
CGAACAGCCGCAGCAGCAACAGAAACGCGGCTGGTTCGGATTTGGACGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62