GenePrediction:GLEAN_5165 Details

Name: GLEAN_5165
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1435507..1431265 (- strand)
Length: 4243
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1435507..1435485 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:1435400..1435332 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_97:1435232..1432983 (- strand)
Length: 2250
Type: CDS
Source: GLEAN
Position: GCSC_97:1431862..1431265 (- strand)
Length: 598
>GLEAN_5165 class=GenePrediction position=GCSC_97:1435507..1431265 (- strand)
ATGGCCGTGAAAGATGAGGATGCGTAAGTGACTCTGCCGACAGCTGTTCCGGCTCTCCCAACGGGCTGTCTACAGCAGGA
CTTAAGCTCACAGTATTCTCCCAACAGATGCTATCCAACCAATTCCCTTATCGCAAAAGAGTCACGCCGGCACTACCGGA
CTCGCATAACTCCAATGTAAGCACACGCGCGCCACGGCTGACATCGTCGGAACCCTGCGGGCAAGGTCACTGCGGCGAAC
CGGTGACAGGCAGCAAGCTGACCTGCATTTCGTAGTCATTGGCAGCTACGATCGCTCATCGGCGTCTCGAGGTCCAACAA
GGTGTACTATCCCACGGGAACGGACAATCTGCACATCCAGGAATTCAACACTGCCACAAAAAAGTCGGAGACGATCGCAC
TCCTGTCCTTCTCCCCGCGATGTCTGGTCGCGCGAGGCGGCTGGGTTTGTTGTGGGGGCGAAGAGGGCGAGTTTGTGGCC
ATCCGGGTGGAAGATCGGAGCCGACGAGTGCGCAATTCGGCGCATGGACGGGTGCGCGACGACTCCCACCACCGATCACA
CAGCCGCGCTCACGGCAGGAGGCGGTCAGACAGTGTTAGGGCCGTTGCCGGTGGCGATGACGGAGACGGCTCGAGGAGCA
TGGACGACGAGGACTACGACGACTTTGACCTGCGGATGGGCGAGCCGCCACGGGCGGCACTGGTCACGGTTCCGTCGCGG
TTTGCGGCCAAGAGCCAGAAGTTTGGAAAGGAGCGGGTCAACTGCATCACGATCTGGTTTCCGTCGTTGATGATGGCCCT
CGCGCCAGGCGCCTATAAACAGGCCGTCGTGGCACTTGCCAACAATGACAAGCATGTCACGCTTGTCAGTCTGGACGAGA
TGGAGGAGCTGGACGAACTGTCGTACCCAGATTGCGTCAACCGGGCGGTGTTGTCGCCTGACGGACGATTTCTTGCGGCC
GTCAGCGACGATCCGTACCTGTACATTCATGAGCGGGTAAAGCGCGATGACGAGGTTCCGCCACCGACGCGCAGGCGCAC
GGATCAGCCTCCAGTGCGCAGTAGCTACGTGTGGAAGCTGCTGGCGCGACATCATCTTCGCGACCAGGATAAGAACGATC
GGACGGTGCATCGCGGCAGCTTTGCAGCGTGCTTTTCCAACACAGGTAGGTATCTGGCTGTCGGAACGCAATATGGAACG
ATCTCGATATTCGATACGGCACTGCTTGGGGAGCCTGGCGACACGTCGCTGGTGGCCTGTTTCACGTCGTCGAGCCCCAA
AGCGGACGCGGGTGCGGTGCGCGAGATGTCATTCTGTCCAGGGCCGTATGACCTGCTGGCGTGGAGCGAGGACTACGGTG
CGGTAGGGATTGCGGACGCGCGGAACAAGTTTGCGGCGCGTCAGATCATCAAGCTCGGTGATGAGTCGGCCTTTGAGCGC
ATTGCGATCAACCAGACCACGCACGTGAACGACGAGCTAGTGGAAGAGCGACAACGCCGACACCAGCGACAGCGTCAGGA
CGGGGAGGACACGGGCGGCCGAGGCGACTCGATGCCACGGTTCCGGAACGGAGACTACGGCGTATCATCAGAGGAGCAGG
CGCTGCGGATCCGGGATGCGCTGGACCGATACCACCTGCCGCTGACGGCGGAAGAGACACAGTTCCTGGACGCACTGCAG
CTGCGGCGAGACCGAGACCGGCGGCTGCAGAGAGAGCAGAGGGAGGCTCAGGCGCAGAGGGAGCAGCGCGAGACGGAGCT
CTTGGCGCGGCCGTCGGCCTGGATCCTGCGGTCGCGGCCAGGTCTCGCTGACGGTGGCAGCAGCAGAAACAACAACGGCA
GCGGCAATGGCAACGACGGTAGTTCTGGGACATCTCGTACGCGTGACCAGGGCCGAGACCGGGACCGGGACCGGGGTGAA
GGGGTGACGGTGAGCGACGTGCTGAGCAGCATCCGTAGTCTCCGCAGCGCACGGGAGCAGGAGCGACGCAACTTTCTGCG
GACACAGGGGCTGCTGCAGGCAGCGATGCAGACGCCGGCGATTCCGACGATTGAGAACGAAGAGTCGGGCACGGACGACG
ACGAGCTCACGGTGCCGATGCCGGTGCCGGTGCCGGTGCCGGTACCGGTGACAACGACGGCACACGGCCAGCAGCGGCGA
CGGCTGCCGTGGGGGAGCCTGGACGCACCGCTGCCCAACTTTGGGACACTGGGAGAGCGAGGCGACGCGCGGACGATTGA
CTTTCTGCACGCTTACACGGTGGGCAACAATGGCGGCGCCGAGGCGGGCAGCAGCAGCAACAACAACGGCGGCAGCGGCA
GCGGCAACGGCAGTGGAACCGGCGGTGTCGGTCGGCGTGAGCGTGGAGCGCTGCCGGGGTCGTCGCTGCTGAGCCAGACG
ATGATGCTGGACTGGGACACGGGCATCGTCAGCATGAGCCGGCGGGCTCGCGAGCCGGCGACGTCGTCGGAACAAAAGGA
CGGACACACGGCCGGTCTGGTGTGGAGCGAAGATGGTACCATATTGTGAGTGTATTCGTGGCAATGCCTTTTATTTTTAT
TTTTGTTTTTTCTTTCTCGCCTTTTTTCTTTCTTCTTTTTACTTCTTCTTTTTCATTCCGTTTAATCTTTGCTAACCTGT
CAGGTTCGTTGGAACGGAAGGAGGAATCTTCGAGCTCCAGGTCAACCTTCGGAACCGGCAATTCTTCCCCAGCATCACGA
TGCGTTGATAGAAGAATGTGGCGGCTGTCCTGTATACTTGATTCGTGCTGTGGTCGTGCTCTGTGTGTTCTGCTCATTTT
GTGCCTAGTTTTCCAACGGCTGCTTCACTTTACGGCGTTCTCTCCTGTCGGGACGTTTTCCTCGCTCGTTATCATTTCTC
ATAGGGGTTTGTTCTGCATCTTGCTTCTCGTCCAGGCCTTATCTTTCATTCGTTTGTATGAGTGCAGCACGGCAAAGAGT
CTCTTGGGTTATCCGTCTTGTGCGTTTCTGCGTGTCTGTGCTACGTATGTTGCTTACATAATCATACTGATCCCCATTTT
GTTTTCGCTCGTCCTTCAGCTGTACAGCAATTCCTCCACCATCTCGCCGATGGCCAGGCTGCTGGTCAGCCCCGGGCTCT
CGATGCCGAGCAAGTTGACCCAGCCGTGGTAGCCGGGTTCCGCGCGGACGACAAAGTCGGCGGCGCCGTGGCCGGCCGGT
GCGAGCTTTGGCCGGATGCCGGCGTAGTCGGGCTGGAGGGCGTCGGCATCAATGTCGGGCAGGTAGGCGCGGATTACAGG
TACGGCCTGGGGCAGACGAGCGGCACCGTGGACGGCGAGGTTGTAGGGATGATCGACCCACTCGACGTCGGGCCCAAAGC
GCATGCGGCCGGCGAGATCGAGGGTCAGATGGGTGCCGAGGCCGGCGAGGCCGGGCTCAGGAGCCGGGTAGATGAGGGTG
GAGACCTTGGGCGAGCTGGCGGCGTAGGAAAAGTAGTTTCCCTTGGCGTAGTAGAGCCGAAGGGGGGGTGGTTGGTGGTA
CTCTTCTTCTCCTTCCTTTTCTTCCTTTTTCTGGTTTTCGTCTTTTCCTCCTTCGTTTCTCCGTTCTTCCCCTTCACTCC
CCCTATCGAACCCTGTTCCCTGGGTGATCATGTTGTAGATGTCAGCCGAGCCGAGTCCGGCCGCGTTGACGAGTGTCTCG
GCGACGACGGTGAACTCTTCAGCCTCGCCGACCGGCCGCACGTGGATGGCCCAACCGCCACTGCCGTCCTTTTTCGTGTG
GCCGAGCGCGCTGATCCGCACCACTGGCGAGCTGAGCGCGACCGTGCCACCAGCCTGCTCGAAGCCGCCCTGCAGCGCCG
CCATCAGGCCATGACTGTCGACGATGCCGGTCGCCAGGCTCTCGAGCACGCCGGCGTCCGCCCGCACGGCCGGCTCGCGG
CGCTGGGCCTCGGCCGCGCTCACCCAGCGGAGCGGCAAGAGTGTGGCGTCGTCGTGGTGCCGGCTGTACTCTCTGGCCGC
GGCGTCGATGCGTTGCAGTGCGGCGAGCTGGGCGGCCGTCTGGGCCACCAGCCACTTGCCCGTGCGGCGATGCGGCACGC
CGTGCGCGGCACAAAAGTCGTACAGCAGCCGGCGGCCGCGGATGCAGAGCTGCGTCTTGAGCGAGTTGGCGCCGTAGTAG
AGGCCGGCGTGGATGACCTCGCTGTTGCGCGAGGATGTCTCCGTGCCGACGGCGGCGTGGCGTTCGAGCACGAGGACGGA
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62