GenePrediction:GLEAN_5166 Details

Name: GLEAN_5166
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1429242..1428633 (- strand)
Length: 610
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1429242..1429194 (- strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_97:1429126..1428633 (- strand)
Length: 494
>GLEAN_5166 class=GenePrediction position=GCSC_97:1429242..1428633 (- strand)
ATGTTATTAACGTCCTCCCAAGTTTCGGTGGCAGTTTCGTCGACCATTGGTACGTCTTCTCGGCGTGTTTGTATCTGGTC
CAATCCGAAACTGACAAGCGGTGGACCATCTCACAGTGATTCTGTGCACTTCGGCCCTTTTCTTCAGCGGATATGTGCTC
CAGCAGCGGACGCTCAATGAGTTGCGCCAGTCCCTTAAGGAGCCTCCACCGACGCCTCCCAAGATCTTTCTTCCGGATCG
TTTCAAGAAGATGACGACAGAGCTGGAAGACGGAACAATCGTGATCCTCGACGATGACGACGACGACACCACTGGTGTTG
GGGGAGATGCGCCGACAGAGGTCGTGGTCCAGGCGAGTATTTCGGTGGCGGAGGACAACCGGAGACAAGAACAGGTCCAA
CTGTCAGGAGAGACGACAAGAAAGGAGGAGACGAGCCAGGAGGACAGCCAGGGCAACATCGACCATGAGCAGGAGGTAAC
AAAGCTCGAGACGTCTGAACATCCGAAGAAGCCCGTCAGCAAAGCAGAGCGGCGACGACTCATCAAGGAGGAGATCAGGC
GGCTATCCCACTACGAAAAACCAATGCTCTACCAACGTCGGCTATACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62