GenePrediction:GLEAN_516 Details

Name: GLEAN_516
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:306928..307420 (+ strand)
Length: 493
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:306928..307030 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_97:307236..307420 (+ strand)
Length: 185
>GLEAN_516 class=GenePrediction position=GCSC_97:306928..307420 (+ strand)
ATGGCTTCTAACGGCAGCGGCTTGACAGACCCCACCAAGGCGTCGGAAGCCATCAGCAAGGGCAAGGGCAAGGCCGCCGA
GGACGACGCCATGAAGGATGCCGGTGCTGCCCCGGCCCACGACGACGATGATGAGGATGATGAGGACGAGGAAGACGATG
GTGCCGAGGTGAGAATCTTCCTGTTATCGATCGGCTGGTGGTGGCAACAAAACTAACAGACTCTGCCTCAGATTGACGAA
GGTAAGGCCCGGAAGAGGGCCCGCTGCAGACACATGTCCGGCTCTACGCACGTACTGACCTGGCACAGAAGACAATGACG
ACGACGACATGCAGGAGATCAACCTCGAGAACGTGGTCGGCCGCCGCACGCGGGGACGGGTCATCGACTTTGCCAAGGCG
GCAGCGGAGAACCCAGCCGCCGACGACGAGGACGATGACGACGACGACTTTGAGGATCCGGACAACAACGACACCAAGAT
GGACGAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62