GenePrediction:GLEAN_5174 Details

Name: GLEAN_5174
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1383250..1382037 (- strand)
Length: 1214
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1383250..1382985 (- strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_97:1382515..1382429 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:1382376..1382037 (- strand)
Length: 340
>GLEAN_5174 class=GenePrediction position=GCSC_97:1383250..1382037 (- strand)
ATGGCAGTAGAATCCAAGGCCGAACAGCGCTTCCGCGTGGCCATTGTGGGTGGCGGTCTAGGCGGGCTAGCGCTGGCCCA
GATGCTGAGGTCGAACGAGCGAGTGCAGGTGACGGTGTATGAGCGGCAGGTGGAGGTGACAGACCGGCTGGCCGGCTACC
GGATCCAGATGGAGCGAGGGGCGATTGCGATGCTGACGAGCCGGGTATCAGCGGGAGTAGGAAAGAACCTGGAACGGAGC
ATTGGCGAGCAGCCGGCATCGGGACAGTAGCTGGGGTTTATGCGGGCAGAGCGGCGCGACAAGATGTTGATGACATGGTA
TCCGCCCAAACTGCGCAGCATGGTGAGCGTGAACCGGTGGATCATGCGCCAGGCGCTGCTCGACGGTGCCGACGGCTTTC
TGCGTGCAGGCAAGAAGCTGGTGCGGTACGATCGGGCAGACGGGGCAGACGGACCGATCAAGCTCTTCTTTGCCGACCAG
ACGACAGCGACGTGCGACCTGCTGGTCGGAGCCGACGGCGTGCACTCGGCCGTGCGTCGACAGCTGCTGCCAGATGTGCG
CGTGCACAACAGCTGCTACGGCGTGACGTACTTCAAGGTGCCGTATGTGCCCGAGACGGCGGCGCTGCTGCCGTTCGGCA
CCGGAGGAGCTGCGCGACGAGATTCGTTCGCGTCTGGCCGACCAGACCGTCGATCCGCTCTTCCGCCAGCTCGTCGACCG
TGTTGCTCTCGACAGCGCCTACTCCAACATCCTCAAGCTCGTCGAGGAGCCACGCCCGTGGTCCGACGGTGCCGTCACCC
TGCTGGGCGATGCCACACTCAAGTACGTCTCTTGTTCCCCATCCTCTCTGCCTTCCCGGACTGACAATCCCTAGCATGTC
CCCGTATACCGGCAAGGGCGCGTCGCTCGCCGTGGCCAACGCCCTCGAGCTGGCAAAGTGCCTCGACCAAGACGACTTTC
TCGACTGTTTGGAACGACGGCGCACACTGCTCAATGGCTACGTTAAGACCATGATCAAGCGTCGACGCAAACAGCGCAAG
GCGGGCGTCTTTGTCCCGCGGCTTGTCTTCTCCGGCAAGAACTCGGTCAAGGTCGACTTGCGCGACAGCCTGTTCCGCAT
CGTCAACGTCGCCGGCCACAGCATGGTTGGTGTGCGCAGAGTGGTGGGGAGTAACCGGTCACCTCACGTCGTCCTTAAAA
TTGAGCCAGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62