GenePrediction:GLEAN_5175 Details

Name: GLEAN_5175
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1380007..1379169 (- strand)
Length: 839
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1380007..1379966 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:1379830..1379761 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_97:1379701..1379169 (- strand)
Length: 533
>GLEAN_5175 class=GenePrediction position=GCSC_97:1380007..1379169 (- strand)
ATGCGGATTTTGTGTCTCCACGGGGCTGGCACCAGCGCTAAAGTAAGACAAGCACCTCAAGAAACTGAAACGTGTTGGGC
TGACGATGGTTCAGATCTTTGCCCTACAGCTTGGTACGGGGTCAACATAGGATCTGGTCTTTGACGCGCTGCTAATAATG
GATTAGCTGCTCTACAGAATCATCTGCGAGATGACAGCATTGCGTTTGAATTTATCGACGGCGAGTGGGATGCACCACCG
GCACCAGGTACGAGATCTTGCGGCCTGTGGACAAGAAATCAGGCCGCTGACATGATGTTGCTGCAGGCATTGCCAAGCTT
TATCCCGGCCCTTACCATGCCTTTTACGACTGGAATCCGGCGGAGCCTAGCCCGCCATGCGAGTCGCTGGCTGAGTCCTA
CGACTACCTGACTGAGGTGCTTGAGGCCAAGGCCTTTGACGGCATCGTCGGCTTCAGTCAGGGCGCTGCGTTGGCAGCGT
CGTACCTGTTGTACCACCAAAACCAGGACCGTCAACTATTGCAGCCGGTCGTCCGCTTTGCCGTCTTCATGTGCGGCACG
CTGCCTTGGGATGCCTCGGGCACGCGGCGATTGGGCTTAGCAGAGCTGGCTAGCAGCGACAGCACGCCGAGAGCGATTAA
CATTCCGACGCTGCACGTGCATGGGGCCATGGATGAATGGTTGGATGAGAGCCGGGCGCTCAAGGAGCTATGCAAGCCGG
CCGAGGCAGTGGTATGGCAGCACGGACTAGGCCACGCGATCCCAGTGGACCGAAAGAGCACCGAGCGACTGGCCGATCTG
TTTCGCGAGGTGATACGACGGGCGATATTTAAGCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62