GenePrediction:GLEAN_5176 Details

Name: GLEAN_5176
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1376537..1374658 (- strand)
Length: 1880
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1376537..1376316 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_97:1376258..1376114 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_97:1376057..1375210 (- strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_97:1374861..1374658 (- strand)
Length: 204
>GLEAN_5176 class=GenePrediction position=GCSC_97:1376537..1374658 (- strand)
ATGGGCGACGCAGGCGACTACGAAGGCGGAGCTGGCTCCCCACACAACAGCAACATGCCCATTGCCGTCGTTGGACTGTC
GTGCCGCTTTCCCGGCGACGCCACGAGTCCGTCGAGGCTGTGGGACATGCTTAGTGCTGGCAAGAGTGCGAGGTCACCTA
TTCCCAAGGACAAGTTCAACGTCGATGCGTTTTTTCATCCGAATCCCGACTGCAACGGAACAGTACGTGGGGCCTCAGCG
GGTGGACGAGACCGCTTGACTGAGTGCTAACCGGTCCAGCTCAACGTTCGCGGAGGACATTTTCTCCAGGAAGACATTGG
TCTGTTCGACTGTTCCTTTTTCAACATCTCGCCCAACGAGGCCAAGGCGATCGACCCGCAGCAACGGCTGCAGCTGGAGT
CTGCATACGAGGCGCTGGAGAATGGTATGTACGCTAGCAGCATCAGGTGTTGTCCGTCTCTTCCTTGCTGACACAGCCAG
CTGGCATCCCAATGGAAAAGGTCGTGGGCAGCGACACGTCTGTGTATGTGGACGTGTTCAACCGCGACTACTCGGAGATG
CTGGCACGCGAAACCGAGACAAGGCCGGTGTACCAGGCGACGGGCAACGGACAGGCCATCCTGTCGAACCGGATCTCGTA
CTTTTTCGACCTCAGGGGCCCCAGCATCACGCTGGACACGGCATGTTTGGCCAGCCTGTCGGCCCTGCATTTGGCCTGCC
AGAGCTATACGTATGACCACCGGGCAGCCGGCTACTCGCGAGTCGAGGGTGTGGCCACGGTCGTTCTCAAGCCGCTCGAC
GATGTTCTGCGTGACGGTGATCCGATCCGCGCCGTCATCCGCCAGACCACCGTCAACCAGGACGGCCGCACGGCCGGAAT
CACGCTGCCCAGCCGGTCGGCCCAGGAGTCGCTCATCCGCACAGCCTATCGCATGGCTGGCCTCGATCCTGCTCTCACCG
GCTACTTTGAGGCCCACGGCACTGGCACCGCTGCCGGAGACCCGCTCGAGGCCGGCGCCATTTCCACTGTTTTTGGGTCC
TGTCGCCCGGCTTCTGATCCCATTATAGTCGGGTCCGTCAAGACCAACCTCGGTCATCTCGAGGGTGCCAGCGGCCTTGC
CGGCCTCATCAAGGCCATCCTCATCCTCGAGCACGGCATGATCCCACCCAACCTCAATTTCGAAAAGGCCAACGAGTCCA
TCCCACTGGAAGAGTGGAACATCAAGGTCCTCCTGCAGCTGCAGCCGTGGCCGAAGCCTGGCCTTCGTCGGGCGTCGGTG
AACTCGTTTGGTTATGGCGGGACGAATGCGCACGTGATCCTTGATGATGTGAGTGCCTGTCGCTCTTTCCTGTTTGGTTT
TCCTATTTTTTTTTCTCCCTGTCTCTCCTGTTTGCACGGAGCTGACGCAATCAGGCATGCAATTTCCTCAAAAAGTACCA
ACTACAAAGTCGTTGATTGAGCAACGGCACAAGCAACCACCACGCCTGCCCCCCAGTACAGCAGAGCCGGGGTTTTTTTG
AGCGCCAACGACGATGCATCGGGCAAGGCATACGCGAAGCGGCTAGCGTCGTACATCCGGCAGAGCAAAGTGGCCGACGC
CGACCGCGAGCTGCAAGACCTCGCATTCAAGCTAGCCGAGCGACGATCACAGCTGCCATAACGCCTAGCAATCAAGGCGG
TGACATCCAAGGAGCTCGTGGCAGCACTGGACGGCACCGATGGCACAGACGGACCCAAGCTGACACGCAGCGCCAAGGCG
CCACGGCTAGCCTTTGTGTTCACAGGCCAGGGAGCACAGTGGTTTGCCATGGGACGGGAGCTGGTCCCAATGTATGCCGT
CTTCCGACAGCGACTGGAGTCGGCCGATACGCTGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62