GenePrediction:GLEAN_5177 Details

Name: GLEAN_5177
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1374633..1369950 (- strand)
Length: 4684
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1374633..1371902 (- strand)
Length: 2732
Type: CDS
Source: GLEAN
Position: GCSC_97:1371841..1371343 (- strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_97:1371290..1371019 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_97:1370934..1370897 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_97:1370587..1369950 (- strand)
Length: 638
>GLEAN_5177 class=GenePrediction position=GCSC_97:1374633..1369950 (- strand)
ATGCAAGAGCTGCTGCGCAGCGAACAGACGACGCGACTGGATGAGCTGTTCCTGTCGCAGCCGGTTTGCACGGCCGTGCA
GCTGGCCCTTGTCGATACGCCGGCATCATGGAGCATCATTTCTTCGGCCGTGGTGGGCCACTCTAGCGGCGAGATTGCGG
CAGCCTACGCAGCTGGAGCGCTGGACTTTGCCGCTGCTATCAAGATCGCCTACTTCCGCGGCCTGGTCTCGGCGACAGTG
CCGGAGCGCTGCGGCCGCAGAGGCGCCATGCTGGCCGTCGGCCTGGGGCGGGCAGCGGCCGAAGAGCGCATTCGTCAGAG
CGTGGCGGCCGACGTCGGCACAGTCACGGTGGCGTGTGTCAACAGCCCGGCCAGCACGACGGTATCGGGTGACGCTGAGG
CAGTGCAGCAGCTGTGCACAAGCCTCCAGGCCGACGGCGTGTTTGCACGCATCCTCAAGGTCGGCGTGGCCTACCACTCA
CACCACATGCACGCCGTGGCCGACGAGTACCTGCGGCTGCTGCAGGGCTGCATCGACCCTAAGCCGGCCCGGCCAGACGT
GCACTTTTTCTCGTCCGTCACTGGCGGCCACATGGCCGACACCACTGCTCTGACTGCGCAGTACTGGGTGCGAAACATGG
TCTCGCCCGTGCTCTTTGCCGATGCGGCCGCGGCGCTCTGCACGGGGACGCTGCAGGGAAAGGCAACGACCCAGCGACGA
CGTCGAACTGCTGCTCGTGATGGCGTCGATATTCTGGTAGAGATTGGACCCCACGCCGCTCTCAGCGGCCCGCTCAAGCA
AATCCTGGCCGAGAAGAAGCAGCAGCAGATCTACGGCCCAGTGCTGGTGCTCGGAAAGGATGCCGTGAATACCACGCTGG
ACCTGGTGATCATGCTCACAACAAGGGGCTACGAAGCCCATTTGGATGCGGTTAACTTCCCGCACGGCCGAGCATCATCG
GTCAAGGTGCTGCAGGACCTGCCGCCGTATGCATGGAACCACACGACGGTGCACTGGGCAGAGTCGCGCATCGGCATGGG
CTACCGGTTTCGCAAGTTCCCACGACACGACCTGGTGGGTGCGCCGGTGGGTGACTTCAACCCGACGGAGCCGCGGTGGC
GCAACTTTATCCGGCTGTCGGAGAACCCGTGGGTGGCCGACCATCAGGTGGCACGCAGAATCCTGTACCCAGCCGCGGGC
ATGATGGTCATGGCCATTGAGGCGATGAGGCAGATGCTGGTCATTGGCGACGTGCAGACGGTCATCGAGGGCTACGAGCT
GCGCGACGTCAACATTGGCAAGGCCCTGGTGGTGCCCGAGTCGGCTGAGGGCGTGGAGACGATGCTGGTGATGCGTCCGG
TGACGGCGAGCGCACGCAGCTCCTCGGACCTGTGGCACGAGTTCCGCATCTTCTCTGTGTCCAAGGTCGAGGGCTGGGTA
GAGCACTCGCGCGGCCGCATTGCCTACCGCTTCCGCCAGCCTCCTTCGGTCGTGGATGGCGGCTGGGAAGCAGCACAACA
CGCGGCCGATATTGCTGAGGCATACACGATATCTCGGGAAGCCTGTGTCAACAAAATCGACGTCCAGGATCTGTACGCGT
CGCTGGACGCCATCGGGCTCTCATACGGCGAGACATTCCGCAATATCACCAGCATGGCCGGCGGGCCGGGTCGATCGTTT
GGCACCATCAAGATCGCCAACACACGCGACGCGATGCCATACCAGTTTGAGCACTCATATCTGATCCACCCAGCAACTCT
GGACTGCGCGCTGCAGGCCATGTTCCCGGCCCTTGCGCCAGCCGGCACGACGGTCGAGACGGCCATGGTGCCGACATTTG
TGCGCAGCATGTTCATCTCGAGCGAGATCTCGAGCGAGCCCGGGCACGAGTATGAGGCCTGGTCTGAGGCACGCTTCGAG
GGCTTCAAGAGCACGACGGCCAGAGTCACGGTGGTCGACAGCCATGACACCACAGCAGTGCGACCCATCATCGAGATCAG
CGGCATGGAGTGTGCGAGCCTGGCAGACCAGTCGACCCCGACTGACGATGACGGCCAGACACGGCCACCGAAGCTCTGCT
TCATCATGGACTGGGATGTGGACGTGAACCTGATGACACAGGCAGACCTCGAGCGGCTTTCGCCCGTCCGGCCGGCTGAC
GAGCAGGACCGCAAGCAGATCGTCACGCACGACATGTATCGCGACAGCATGGGCATCGATCGTTGCTACGAGCACATGGC
GGCCTACATGGACAAACTGGCGCACAAGTACCCGACGCTGCGCGTACTTGAGATTGGTGCGGGCACAGGTGGTGCGACGT
TGCCGATGCTGCAGACGCTGGGAGGAAGAGGAAGCGGCCCGAGACGGAAGCACTACGGCCGGCTCAGCAGCTACGACTTT
ACCGACATCTCAACCGGATTTTTTGAGAAGGCGCGCGAGAACTTCAAGGACTGGGCCGGGCTGGTGCACTTCCGCAAACT
CGACATTGAGCAGCGGCCAGTCGAACAGGGCTTTGACGAGGGCACGTACGACGTCGTCGTGGCGGCCAACGTGCTGCACG
CAACCCGGCAGATGCGCGTCACGCTGGACCACGTGCGGCGGCTGCTGAAGCCAGACGGCAAGCTGGTCCTGATGGAGATC
ACCGAGCGCACGCTGCGCATGACGCTGACGCTGGGCAACCTGCCAGGCTGGTGGTTGGGCGCAGCCGAGGGCCGTGTCGA
AGGCCCGTCGTTGTCAGTGGCCGAGTGGGATGGCCTGCTGCAAGAGACCGGCTTCTCCGGCCTGTAGATGAGCTTGCCCG
ACTATCTCAACGTCAGCGACCGGTTCTACAGTGCCATCACGGCGACGGCCGTCGAAGCTGTCGAGCACGCCCTTCCTCCC
ATCCTCGTCGTTCCACCGACAGAGGCCAGCACGAGCCCGATGACGACAGTTGACCGTGTCATTGAAAGCATCAGGGCCAC
GACGGTGTCTCGCGTCTCCCTGTCCCAGCTGGCGGCTGCCAATGCGGCCGGCGCCCTGATCGTCTTCCTCGCCGAGCTCG
AGTCGCCGCTGCTGGCGACGGTGTCGGCAGCCGACTTTGACGCCATCCGCGGGGCCATTGGCGCGGCCAAGGGTATCTTC
TGGGTGGCCCGTGGCGGCACTGTCGAGGGGCACGTGCCCGAGGCAAACCTGATTACAGGACTTTCCAGGACGATCAGGGC
CGAGAAGCATGCTCTCAAATTTGTCACATTGGATTTAGATGGGGAGAGGATGGTGGCGGATGACAGTGAGAAGGACAACA
CCAACATCGACGTCAACGTCATCATTCGAGTCAGCTCATGTGGAACTGGCACCGTTTGTACAGCCAGGCCGGCCACTGAA
GCTGGACATTGGCGTGCCGGGACTGCTAGACAGTCTGCGGTTCATCGACGACCCGATGCACACACCAGCACAAGACGGCA
CAGAACCACCGCCACTAGGACAGGACGAGGTCGGCATTGACATCCGCGCAACGGGCGTCAACTTCAAGGACATCATGGTC
TCGATGGGACAACTGGTCGAAGACTTTCTCGGCTGGGAACACGCGGCATGGTGGATGACGGGCTGCAGTCGGCGGCGGAG
GACGAGGGCGGGGCGGTTCATCTGGCGGCTGGTCCAAGTTTTGCTTCACTAATGATGACATAAGCCCGGAGACCCAGGTT
CGAAGTAACCGGTCGACAGAACCAGCTACATTATGCGCGACGCAAAGTCTCAGACCGGTAAGCCGTCCGGGAGTAGTATT
AAACAAGAAGACTAATGCAGCTCTATACTAGCGTCGTAGTCATCGCACGTCTATGGCTGCCCCTCGTTTTCTCAGCCGTT
TCCCCAATGTCCTTCAAGTCTGCATCTTCCGGTCTGTGTTCTGCCCAAGGCCTGATGCGTGTACGTACAATCTGCCTACT
CGCTATATTTTGAAACTCAAGCCAGCCATCATGACTACGAAGATACCGCAAGCTGAGAGCCTTGTAGCAGCCGGATTGCG
GCCCCGGAAACTGGCTCCGTCAGACGCCCAGTACATGGCTCGGCAGGATTCGTACTGGTCCAGTATGCATTCCTGCAGCC
CCATACGGCCGAGGAAGTGGACATGGCTGCCAAGGCGCTAGTGTCGTCGGGGCAGAAGTTTGCCGTCCGCAGTGGTGGCC
ACACAGGCTGGGCTGGATCCAATAATATTGAGGGCGGCGTGACAATGGACCTCGAGCATCTCCACCGTGTGGAGTACGAC
GGGGCCAGTGAGACGGTGCACATCGGCCCCCGCAGCCGGTGCACATCGGCCCCCGCAGCCGGTGGCGCTAGGTGTACGCC
GAGCTGGACCAGTACGGACGGGTGGTGGCTGGTGGACGCGAAGGAAACGTTGGCGTGGCGGGCTTCCTTCATGGCCGGTC
ACGGCTTCGAGTGCGACAACGTGCTTGCGTATGAGGTGGTGCTGGCTACGGGCGAAATCATGGCTGTTGGCCCAACTGGC
CCCCATGCTGATCTGTTCCGTGCGCTCAAGGGCGGCTCCAACAACTTCGGCATTGTCACAGACTTCAGCATGAAGGCCAT
TCCGTGCAGCAAAGTCTGGGGTGGCATGGCCTTCCTACCCAAGACGGCTATCCCCGGCGCTATCGAGGCCTTGTCGGCCT
TCACCGACAATATCCCCAACGACCCGGACAGCAACCTCTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62