GenePrediction:GLEAN_5179 Details

Name: GLEAN_5179
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1360470..1357868 (- strand)
Length: 2603
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1360470..1360037 (- strand)
Length: 434
Type: CDS
Source: GLEAN
Position: GCSC_97:1359976..1359277 (- strand)
Length: 700
Type: CDS
Source: GLEAN
Position: GCSC_97:1359208..1359132 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:1359070..1358357 (- strand)
Length: 714
Type: CDS
Source: GLEAN
Position: GCSC_97:1358195..1357868 (- strand)
Length: 328
>GLEAN_5179 class=GenePrediction position=GCSC_97:1360470..1357868 (- strand)
ATGGCGGACATCCTGGGCACTGCAGCAACTGTGCTACAGCTCATTGGTGCTATCAAGACCACCTGGGACTTTTTCGATGA
AATGCATAAAGCTCCAAGGACGGTGCTGAAATACCAGCGCATGATCGAAAACCTGGAGATAACCCTTCAATTTGTCAAAG
ACTACTACTCACTCCTCTCCATAAATCAACTCGCCAATGTCCAGGAAGCTCTAAGCTCCAAGCACATCTCGGAAACCTCC
ATCGGCAGGATTTTGGACAAAATACGCCAAGATCTAGAGGTCGTTTCAACCGAGCTCAGAAAGCACTCGGACAACAGCTT
GAAGCTCCTAGCCAACGCCAAATTGGTCTTCCGAAAAGCGTCTATTGTCGAGGCGTTTGAGAACATAGAATACGAAAAGT
CATCACTCTCTCTGATACTCGGCTCTATTCAGGGGTATGCTTTGGATTTGTTTCTTTTCTCTCTTATTGTCAACAACCAT
TGACACTTTCAAAGAATGATAGCCGCTACTCAGTTTGCCTCGATACAAGCCCAAACTCAAAGGTCGATTCTTTTTACCGA
TGCCGATTATGTGGTGGACCAGCTGCGGTCCAGCATCGTCCATGCTGTGCAAAACTCGGCAATGTTCAGCAAGTCTTTAA
ACGGGTCATCCATGAACCTTCTTACAGGTTGTGATGACGATGAAAACTACGACAATGTTGACGTCGAAGCTGGGAGTCGC
CGTCTCTCTTTGTCTATCGCCTCCCGTCAGTCTTCTCAAAAATTAGTCTGCAACAAGGACGTTTCAGTCACGCTGCCCCA
CATCGACAACGTTGAAGATGACGGCTACTATATCCAGGATGCGGATATGTACGGTTGCAAGAGCCGCTTCGGCAGCATCA
TAATCCACGTTTCAACATACTGTTCCAAAACCTCTATCTTCCACAGGCCTCTCATCAACATACAGGCCAGCCTGTCGCTC
CGAAAGAGCTCATTGATGCATGGGAGGGTCTTCCAGTTTCGGTTCCAGCAAGTGATGCACACTTCCAGGTTGTCGGGGCT
GTTTTCCTCCTCTAGCAGTGGCCGCATCTTTAGAGAAAACAGTCTCGCCATTCAATGTATCGCTGCTGGAAACTGGCAGG
GAATCAGAGACCTTCCAAGCCGACGCCAGATCTCGGTATACGACACAGATGATTACGGTCGAACCTATCTTCATGTGAGT
CAGAATGGCAGCCAGACAGCTTTATTCAAAGTCTACGAAACGCTACTAACTCAATATGACAGTATGCGGCGACACATGGC
TTGGTCGATATAGCAAAGACGCTGATCCAAGAGGGTGCGGACCCTGGAGCAAAAGACCAGTGCGTTCCTATTTGAATGCT
CGTCCACTCTTGCTGCTCGCTTTGACTGACATCTCTGTAGTTTTGCAACCACTCCGCTGGACCAGCTTCTCATGTATGGG
CCAGGCAACTCCATGCTTCTCAGCCAGATCTACAGCAGCGCAAACAAGGACCCATTGAGCCGCTTTGTGGACTGTTTTTA
CTTTTTGCAGTTCAGGGGAATCAACCCCGACTGTATTGGAACCAAGCGGGGCAGTGATGGCATCAGCAGCCGGCATTCCG
ACATGGCGGCTCTCGGCGTCCGTGCCGGCACCCCTGGCTCTCAGTCTGCTGCAGTTGTGCAGGGCTGGAGAACTTTTATT
TCGGGCGTCGGGGCCAACGTCAACGCCAACCTGGCCCACCACAATAGCAGTGCATTGTCCCTGCTAGCGGCCTCTCGCCA
CTCGACGGCCACATCTATACAGGCCCTCTTAGCTCTCGGGGCGGATGTGAACTATACTGACGTCAACAATATGCAGCCGC
TACACTACTTCTTCCACTACGCCTACTCGAGCACAACGAATCAGCCCCTGATCCCCTCCCAGCGCAGGGCCGTGCAGGAC
AAGACATTTACCCTGATCGAGGCCGGGGCAGATCTCTGCTTCCGGGACCGCTGGGGTCGGAAGCCCAAGCATCTCGCCGC
CCGTGCTGGGCTGCTGGACGAGTACAAGGAGGCCGTCAGAAGGTCGAGACATTCTGGGCTCGACTCGTTTGCCGAGGGTG
AAGAGTGGCACCGCTGGTTTGATGTGCCGGTGCAGTGTGATTCTGGTCGAGTACCGCACAAGGGAAAAGATCGCCAGCAC
CGAAATGGAAGCGCAATCCCACACAAACTCGTACACAGACTCGAGCATGGATACGTACATGGGCATTTACACGGACACGG
ACACCGGGACAGTCACATAACGACAACAGCTACAGAAGCAAACACCACAGCAGAGACGAGACCACATCAATACCTGAGAC
CACACAACTTCTCTGTGCATCTCAGCCTCCTCTTCAGACCAGCTCACCAGAACACGAGATAGCACATGTTCCTAAGGACG
TCCTTGGACTTCACCAGGATGACGGATACCTCGAGCCTAGGCCTATCTCGGAGATTGCTAGCCACCCCTGGCTTCCATTC
TACATGCTCCTCCGTTTTGCTGTCTTCTTCCTCAACAGCCTGCACAAGGAGCTGATCTGCTGTGTCTTTTCGGTCGGTCT
ATCTGCGCTGTTGGATTTTATCGCTCTGGTGAAGAGCTATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62