GenePrediction:GLEAN_517 Details

Name: GLEAN_517
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:308404..309423 (+ strand)
Length: 1020
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:308404..308489 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_97:308793..309002 (+ strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_97:309061..309154 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:309217..309423 (+ strand)
Length: 207
>GLEAN_517 class=GenePrediction position=GCSC_97:308404..309423 (+ strand)
ATGGACGGCCGCACAGCAGCACAGGCACAAGCACGAAAGCAGTACGTCTTTTGGAAACGACAGGTGGCGCATCTCGATCC
AGCAATGTGCGTTCCGAAGCAGCAGTGCCGCGACACTCTGCTCCTGCCAGCCTCTCTGTCTTTACGATGCGCAAGCTTTG
ACAGGCCAGGATCCGGCCTGTGGCCATGGCGTGTTTCCCGTTTGATCGAACAAGAGATGGCCCAGATCGACTCCATTGAC
TGGCCCAAGTTTCCCACCATCTCGTCTCGACCAGCTCGTGCCCGCTGCTTGCCTTCTGTCGCTCCCGAATATGCCAGTCA
GCTGCGGCTGTGCCACCGTTATATCCGTCTCTCGAACGACCAAGGCTAAGCGCATACCCGTGTCTCTAGATTTGGCTCCT
CCAGCCTGCACCAGCGAGATCCTCGCAGTGCGCTCTTCGAGGGCTACACCGGCTCCGGCTCCGAGTCGACGCGGCGCAAC
GGCAGCGCCAGCCCCGGACAATATGGTGGCGGCTACGGCTACGGCTACCCGGGCAGCAACGGCAACAACCTGACTGCACC
GGCACACAACGCCTTCCGGCCAGCGACGCCCAACCGGAAGTAAGCCGGCACGCCCGCCTATTCCGTCGGCCCATTGCTGA
CGCTGGGGGGATTCTAGGGGCCAATACAGCGATGCCGTCCTGAACGAGCTCGAGAGCCAAAACGACCAGCAGATCGAGGG
CATCTTGGGCAAAGTCCGCGTACTGAAAGACGTGCGTCTCACCTCTGCAGTTTCGCACACACTCTCACACACCTGACCTG
ACTCTTCTCGCAGATGACGGTTGCCATTGGCGACGAGATCCGGGAATCGTCGGCGCTGGCCGACAAGATGAACGACTCCT
TTGACGCTACGCGGATCCGGCTGCGCGGGACGATGAACCGGATGTTGCTGATGGCCGAGCGGACGGGCGTTGGCTGGAAG
GTGTGGTTGGGCTTCTTCGCCGCCGTGGCGATGCTGTTCACGTACGTCTGGCTGTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62