GenePrediction:GLEAN_5180 Details

Name: GLEAN_5180
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1350851..1347086 (- strand)
Length: 3766
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1350851..1350749 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_97:1349213..1347965 (- strand)
Length: 1249
Type: CDS
Source: GLEAN
Position: GCSC_97:1347899..1347086 (- strand)
Length: 814
>GLEAN_5180 class=GenePrediction position=GCSC_97:1350851..1347086 (- strand)
ATGAATTCCGACATCTCGCGCAAGTATCGGCGTCTTCCCGACGACGCCTTCATGACGGATGCGGTGGAAGCAGCAGACCC
GGGCGTCAGACCGACCGCTGTGGGTCTTACCGGGATCCGTGTACAGAAAGCAACTCCTTGGGTTGTAGCTTCACTATTCG
CTTTTATCTCAGTGCTTCAATTCTTCGTATATAATCTACGTGCAGAAGCAGGCAGCTTTAAGAAAGGATGGGCAACAGAT
TTTGGTATAAAAATATTCTTCTCTTAGAAAATTACACAATACTGAATTTCCTCCAGGTCCTATTCACAGCTCTATCGCCA
TAGAACAAATCCGGTTTACCGGCGGTGCGCAGTTTAGTGAAACAGGCAAGTATGGGATCACTGCAAACTCGGAAGCTCAA
TATACTGGCGATCCTAGTCCAGAAATTGACAGAAATTGGGAGGAATTGACATGGGGTAAGTAACGGCTATGTATGGGCCT
CATTCTATCATTATTGTTACACAATTCTGCAGAAACACGCCTATCACTCCTAGTTTGACCTTCTTTTTGACAGGACGATA
TATCCTACTTACGGCCGACGAAGCTAAGGACGCGTTTACGGAAGGCTATGGAAAGGACTTACAAAATCTTTGGAGTCCCC
GCCACGGTGGCTACTATGCTGGGTACCGTTTTTTTTTTGTCAGTTGTGCGAGGATATGAGGGCGTTTTCTAACTTTCTAT
AGATTTTCCATGTTCCATACTTTACACTGTCTAAATCGTTTGCGGAAGGCTTTTTATCCTGTAAGCAAAGAGCAGCATGT
TTCATAGTAATCCCAGACAACAGCTTAACCCGGAAGCTATAGGATTACTATCCCATGGATGAGAATCCGAATCATCTCAC
ACATAGGGGTACGTTTGCTTGTGTTTGATTAGCATGAATGAAAACGAGCTAACATTTCATAAAGATCACTGCTTCGAGCA
AATACGCCAGTACATCCTATGTTCAGGGGATCTGACTCCGGTCCCGACGGTTTACAACAAACTCCGTGATGTCAACTACG
TGGACTCTAATTTGAAGCACACCTGTAGGGCCTTTCAGCCTATTCGGGAATGGCTTAGTGAGCGTTATAACGGCAGCCAG
GCGGTACAGCCCAAATGTCCTGATGGGACGTTCTATTCCCATGGCAAGTTGATGTGCAGTGGCCATTGAAAATCACGTCA
ATTTTGTGTATATATAGATAGAACGATTACGGTGTAATGTACGGACTATCTGGCTATGGAATATGCCCCCGCTTCTGTCG
AGATTGTAAGATACGATGTAAGATATAGAGTACACTTAGCACGGTGGTTTGTTTAGCACATGGGCCCAAAGTACAAAACA
ACTCGAAAAGCCTTACTATGCCTCGGCTATGCCGAGCACAATGCCACGTTCTCTACGGAGTACTTCAGAGGAAAGATAAG
TCTGATATCATATCATACTGATCGACGCATGTAGTGTACTCCCCTTAAAGGTACATATAATAGCGCAAACCCATAAGTTT
CGTTTCTTAGATTCGCTGTATTTCCACGCCCAGCAATATATCTCTACGCACAGAGTTCTTTTTGCATTTAAAAATTTGTC
GGAGTCGCCTCAGTCACTGATTGTCTTTCCGTCGGAAGCATCCGCTATCATCCAAAGAGCTGAGCACGCAATAGCCAAGA
CCAAAGCTGTTGAGGACGCTGTTGTCAATACTGTTTCCCTTGACACGGCTAGTTTCAATAGCCTGCTGCCACTCATATAC
GCGGAGAACAAACAGCGGCTAGAAGAGAGGGTGTTGGGAATTTACGCTTCAGTATCTTCAAGCCCAGAATTACGAGAGGC
TTCTCTGGCCGCTGCTCGTCTGTTCAGCAATGCCAGCACGGCATCGTTGATGCGCGAGGACATATTTCGTCTTATAAACC
ACGTGTTTGAACATGAAAACGAGTCGCTAGATGCCGAGTCCGCCCATTATCTACGACGGCAGCACCAGAAGTACCTTGAT
CACGGCCTGCAGATACCGACGGCCTCCGAGCGGGAGCGTCTCCGGGAATTACGCCATAGAATCGGCGAGCTTACGCGATC
GTGCCAGAAGAATTTCAATAGCGGAGATGAAGGCTTGTGGCTAGACTCTGGTTGTCTGGCCGGCATTCCTAAGCGGGTGC
TATCAAACTTGCAGCCCGGTGAGGATGAAAACAGAGGAAAGATTTGGTACCCCATCAAGAATTCAGATGTCGCGATCCTC
TTGCAGACGGCAGAGGATCCAGAGCTTCGAAAGGAAGTCTTTCTCGCCGCAGAGAAGAGATATCCCGAGAATGCTGAATT
GATGACCGGACTCTTTCTCGCTCGTGATGAGATGGCACGGCTGCTCGGCCACACGTCGTATGCATCGATGCAATTGCGAG
ATAACGTGGCCAAAACACCGGAGGGGGTGGAGGCGTTTTTATCAGATCTAGTGCAGAGACTCAAGCCTCATGCCCAGATC
CAACTGGGGCAGCTACTGGAGACAAAAAACGCCGAGCAGGCCGCTTCCAGTAATGAGCCATCGCCTTTGCTTTATTGGGA
CCTCACTTACTATCGCGCTCGGGTTTTAGACAAAACGCTCGGAGTCAATCATAGCGAGATAGCACAGTATTTCCCGTTCG
AAGCAGTTCTCCCAAGACTTCTCCTTACATTTGAACGACTGCTTGAAGTGGAGACGCGCCCGGTATCTTCAAAGGGCGAC
AATTTGGTATGGCATCCAGATGTTTCTATACTTGCAGTTTGGGACACCAGCAGAAACAACCCTGAGAAGGAGTTTTTGGG
TTACATATACCTAGACCTACACCCCCGACCTCTAAAGCGACCCAGGGGTGGACACTGGCGCCTTCATCCGGGAAATTTGC
GAGAAAAGTAAGTAACTTGTTCTTACGTATTTGTCATCGTTTGTATCTTCTAAACATTAATCTATTGTGCAGTGGTACCC
GTCACTGCCCTTCATCGGCCATTGTGTTCAACATCGCAAAGCCTGCGGACGGGAAGCCCTCGCTTATGAGCCACGCTGAG
GTTGTCTCTTTATTTCATGAGCTTGGTCATAGCTTCCGAAACTTAACTACCAAGACCCGGTTTGCTGCTAGTCACGGCGG
GTACGACACAGACTTTATTGAAACCCCAAGCAAGCTCCTTGACAACTTTTTTTGGTCTGCAGGGCCTCTTCGAGACCTCG
GAAAGCACTACAGTTACTTGTCGCCTGAATACGAGGCTCTGTGGGAAGCAGAGAACGCAGGAGGTCAAGATGGCCACAGA
AGGCCACCCGAAACGCTTCCAGAAGCCACCATCGACAGCCTCGTGTCCTCACGATACCAATGCAACGCCATCGAGACGAT
GCGCCAGGTAGCCCTTGCGATGTTTGCGCTCCGTGTGCATAATCCGGCCACCCGATCGGAGCTAGAGGCCTTAGACATCG
CCTCTATGTACAACGCATTGCGGGACGAGTACACCATGCTGTCGATTGGGCATGAACAACCAGGCCACAACCAAACGGCC
TTCTCACACGTGTTCGGCCACTGGTCTGCATCGTACTACAGTTATCTACACTCTACAGCAGTTGCCGCCGACTTATTCAG
CTCCGAGGAAGGCTTCAAAGGCAACCCCTTCAACAAGGTGGCAGGGCGTAGATGGCGCCGTACCGTCTTGGAGCCTGGTG
GTAGCCGGCCACAGGCGGGCTTGCTACAGGAATTTCTTGGGAGAGAGCCGACGAATGCAACATTTGTCCATAGTCTGGTA
GGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62