GenePrediction:GLEAN_5183 Details

Name: GLEAN_5183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1330919..1326374 (- strand)
Length: 4546
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1330919..1330841 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_97:1330547..1329652 (- strand)
Length: 896
Type: CDS
Source: GLEAN
Position: GCSC_97:1329360..1328741 (- strand)
Length: 620
Type: CDS
Source: GLEAN
Position: GCSC_97:1328679..1328575 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_97:1328500..1328444 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_97:1328219..1326374 (- strand)
Length: 1846
>GLEAN_5183 class=GenePrediction position=GCSC_97:1330919..1326374 (- strand)
ATGAAGAAGAGCTGCTCGCTGCTCGAAGAGGAAGCAAAGAGGCTCGGCGTCTGGCCAACCGAAGATGTGAAGCGTCCAAG
TGGGGGGGGAAAGACAAATGGGAGGGGAGTGGAAACGAGAAAAAACGACGCCGTGCAGGATTGCTCGCACTTGCCGCTGT
TTGGCTGGTTGCTGCCCCTTTGTTTAGTGCCAACAGCCGCGTCGTTGTTGCCGTGGCAGTGTGCTAGCGTCGCGCTCTGT
TATCTAATCAGCGTGACGCAGTATTCGGTAATTACGGAGTACATACATACCTACATAGTACAGTACCGTACTTTGTGCCC
CGCTATGCAGCCTTACCTGAAGGACGGAGTTGCTACGACGTACGACGAACAGCCGAGCTTCTCGAACCCGACACGAGGAC
GTCGCTCGCTCTGACCGACACCACCGTCGACCCGCTCGCGTCGCACGTTGTTCTCGATCCGTGCGCATACAAATGCCCCC
CGCCTCTCCAACCTATGGCCATTGTTCCTAAACTCCAGACGGCCACCACGTCGGCGATGGCTTCGACCACGTCTGCCGTG
CCTGTCGAGACGGCCGTGTCCACTCCTCCCTCGATCGAGAAGGCCAAGGAGCCACTGTTTCCCCTGCCGAAGCTGCGGCT
GGAGGTCCGCGATCTCAGCCACGCCGGCGCTGATGTCTTTTTGGGGGCGGTCAACGCGGCTGCTGTACTGGCAGCGGCCG
TGGCCAACGTGCAGCGGCTGCTCTACGCCAGCGACGCCAAGACGGCCGATCCGGCCACGCACATGACGCCGACGCGCTCC
GTCACCGTCGTCCTGCGCGACCTCGACGGCGTCGCCTACACGACCGGCAGCGACCTCGATGGCGACCACAAGGAGATCCA
CTTCAGCCTGGGTTACATTGCCGGCATTCAGCCAAGGGCCTCGCGCGCTGTTGCCGAGATCACTGGCGTGCTCACTCACG
AACTCGTCCACTGCTACCAATGGAACGGCCTCGGTACCGCTCCCGGTGGCCTCATCGAGGGCATCGCCGACTGGGTGCGG
CTGCGCTGCGCCCTCGAGCCGCCGCACTGGAAGCGCGAGCCCGCCGCTGCCGGCCGCTGGGATGCTGGCTACCAGCACAC
CGGATACTTTCTCGACTACCTCGAGCACCGCTTCGGCCACGGCACCGTCCGCCGCATCAACGAGAAGCTGCGCCGTCACC
GCTACGAGGAGAAGCCCTTCTGGACCGACCTCGTCGGCAGGCCCGTCGAGCAGCTGTGGGGCGACTACGTCGACGCCATC
GGCAAGGAAATATGAGCTCAAGCTTGGAGCATGGAGCATAGACTCATGGTCAGCGTCCAAATCTTGTTATACACTGTAGT
CTTCCGCACTCGTAGTTCATAGTCAAATCGACAGCTGCTGCCGGCCGGCAGCTGTATTGCGGGCGATTAGTCATCACCAA
TGACCAACCACGTGATGGGAATTACAAAGTTGGGGGGCCGATCTTTCCTGTCCACCGTTTCCGAGCCTTGACGGAATCCA
CTTTTTGGACTCTCGCAAACCTCGACAAAGCGAGCACAGCGAACGGACGCCGCCATTGCCACCGCAGTTCATCCACCACC
AATATCCAAGGCAGCGACGATGCGAGCGACACTCCGCCTGCTGGCTGGCGTGAAGCCGGTGCGGTACTTCCAGCCGGGAG
CGCAGACGGGACTGGCGGGCGTGTACACGCACAGCACGCCGCGGTCGACGCTGCTTTACCTGTACACGACCACGCTGGAG
AAGCTGCAGGCGGTACCGGAGACGTCAGTGTACCGGCAGTCGGTGGAGGCGCTGACAAAGCACCGGATGGCGTTGGTGCA
GTCGGTTAAGCCGGACGGCTACGACGAGTGGCGGCAGCGAGCGCAGAAGCTGGTGGCCGAGAACCCGGAGCAGTTTGGCA
CGGTGGCACAGACGAGCGTAGACGGAACGGCGTCGTGGCGCGTGAGCAAGGGCGGCCAGACGTTTGTCATCCTGGACGTG
CCCAACCAGGTCGACCCGCGGCTGCAGGAGTGGGACGGCGAGCGGGATGAGGGCCCGGAGCTGGAGGGTATCCGCACGGC
CGAAGACCGTGCGGATCACGGCCTGTCGGCGACGCGCAAGTCGCTCGAGGTCAACCACAACGTCGCGTGGGAGGATGAGC
CGCGTCTGACGGCGGACCAGTGAGTGTAACCCACGACGGCTAGCGGGCGGCCACACGAACAGATTAGCTGACCCTGCCAG
GATCGAGGAGCTCGAGACCAAGCTCGGCGCCGGCCTCATCGAGGAGGTCATTGGCGTGGCCGAGGGCGAGGCCAAGCTCG
TGGACGTCATGGTCAAGGCCAAGGTGTAAGTGACGATGGTTCTCCCTTCTGCTTTCTTGTTTTTATCCTTTCCTTCGCTG
ACATTCTTCTTGCAAACAGCTGGGAGAGCCTGGAGGAGAAGCCGGCCGAGGGCCAATGGGTGTACTTTGAGCGCAAGTAG
AGGATCAATTCGAGCCTTGGCGAGGACAAGGAATTATGTATAACTACATAGAAAGCGCAGTGTACATAAGCGTGCCAATG
AAACCCATGGACCACTATTTGCAACGGCGACGTGCCTGCCGTATTCTGTACAGATATCTTACGTTGCTGGCGGCTTCCCG
AATCACCAGGCAAATACGGAGCAGTGAAAAATAAAGAGAATAAAAATTGAACAAAAGCAGTGGGGCATCCGCACCAACAG
CCAAAGCTTCCCCTTCAGACCGACGACACCGACACGCCTGCACGCCTGCGCGCCGCCAGCCCGCCATGGCTTTTATCGAG
CCGCCGACGTCGACGAACCTGCGGAAGCGCAAGCGGGCCTCGTGCGCCTCGCGCGCCTCTTCGACAACCTCCAGCGCAGC
TGGCCGGCTGCCGTCCGACGCCATCAATCCACATAGCTATGGGCCCTTGACATGGAAGCAGCTGACGGTGGCGGGACTGA
CGCAGGCCGACCATCTGCCGGCCGACTACGTGGGTGGCTTTCCGCACCGGCCGCTTCCGCGAGACAGCACAAACGCGACA
CCTGTGCAGGGCAGCGACGAGGAGGAGAGTGGAGGGAACGGAGAGGGCGGCACCGACAATGAGGGCGGCAGCGAAGAGGA
AGCCCATGGCCATGGGCACAGCCACGGTCATGGCCACGGTCACGGTCACGGCGATAATCGCTCGGCTGCCAAGCGCCACC
GCGCTGCGCTGCGCACGGTCAACGCCTACGACCGACACATCGGTCTGCTGACAGCAGTGGTGCAGCGGGGGCTGCAGGAA
GCGGACCACGGCATGGCCAGTCTGGGGTCCGAAAGGGGAGTCGTCGGGCTCGCGCGGGCCAAACGAGCCTTTGGCCTGCT
GCTGCGGACCGAGGTCGACGGCCGGATCATCGACCTGCGACGGGACCACCTCTGGGCGCTGGGGGCGGAGATTCTGATGC
GCGAGGGAGAAGACGAGGCGGCGGAAGAGACGGTGGAGAAGACGGTGGAGGAACACGACGGGGACGAAACGGACGAGACC
GACGGGACAGACGGGACAGACGGGACAGACGGGACAGACGAGACAGACGAGACAGACGAGACAGACACGAAATCTAATGT
CCGTCGCCGTCGCTGGGGATCGGCCGCCAATCTGCCCAGCGTGCGAGCCTACTACGAGGACCTCATCCAGCAGCACCCGT
ACAGTCGACAGTGGCCACGAGTGCCGAGCGCGCTGACCTTTTGGCCGGCCATGATCAGCACAGAGCTGTACAACGTTTAT
ACAGAAGAGCGGCATGCGATGGAGCGATTAGAGAAGGAGGAGGAAGAGGAGGATGAAGAGGAGGACGAGGAGGACGAAAG
TGACGAAGATCTTGGCGACGAAGAAGAGGAAGACGACGAAGATGAAGAGCACACCAACATCCACACCCACACCCACACCC
ACCGCCGTCGCCGCCTCTTCCGACGACGTCGTGCTGACCCCCAGCGAGCCGCCCGCGAAGACGTCCGGACGGCAGCGCTG
CAGCAAGTCCGCGACATGGCCCGTCGCATGGACATCGTCATGGAGAGCCCGCCATACCGGGCCAGCCATGAGATGCTGCG
GCTGCGCGGCATGGTGGCGCTCTACGCGGGCGACTTGGTGGTGACGACGAGACCGCGGACGCGCCGTGAAGCGGTCGAGG
ACCAGCGGCTACGGACGGCCGAGCGGACACGAGCGCGGGCCCTGTTTGCGCGACTGGTGCGGGACGATCGGGGCGGCGAC
AGCAGCACGGGTGGGAAGAGCCGGCAGGCGGGCATCAGGACGGATAGCGTGGTGGATGCATATGTGGAGGAGATGGTAGA
AGGGAAGGAGAGAGGGGGGGAGAGGGAGAAGAGGAAGAAGACAAGAAAGTCAAAGGACAGATCGAGAGAGAAGTCGAGGG
ACAAGTCGAGGGAGAAGGCGAGAAACAGCAGAAGCAGAAGCGCCGACAGCAGAGACACACACGACGGGTCAGAGGACGAC
GACGACAGCTATGGCATGTTGGATCGGCCAGTGTTCACGTCCATGCCGATCCGGCAGTCACAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62