GenePrediction:GLEAN_5184 Details

Name: GLEAN_5184
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1319955..1318013 (- strand)
Length: 1943
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1319955..1319928 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_97:1319825..1319529 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_97:1319469..1318013 (- strand)
Length: 1457
>GLEAN_5184 class=GenePrediction position=GCSC_97:1319955..1318013 (- strand)
ATGGAGCAAACTTTTATGACCATTCACAGTGAGTCTTCACTGTATCTCGCTTTTCTCTTTCAGCGTCCGCTACCTTTCTG
GTGGCTTTGTGCGATTGCTGACCACCTCACCTCACTCCCCTCCTGTGCAGACCTCACACAAGATGCAAATATCCTCTTTG
CGTCTGAATCCATTACAGACATTCTTGGGTACCAACCGGCTGAGGTGCAAGGAAAGTCGTGCTTCGACTTCTTCCACCCG
GAAGAGGAGCCCTCTGCTCGCTCCGTTCACAGCCGTGGCGTGCTGCTTGACAAAGCTGCCGTGCTACATTATGCCCGTCT
CCTGACGCGTGATGGCCGCTGGATCGGCTGTGAGTGCTGCTTCACTATCGTCCATGACGTTTTGGTAGCATGCGTGAGCA
TCTACCACAAAGGAGCCAAGAGCAAACGTGAGTCTCTCCTGGTACGCGATGCGCCTCTTTTCCACAGTACAGGCTAATGC
GTCCAGGCCGAGCAATCGAAGCGCCGCAGATACGGCGCATATTTTCTTGCTCTCCACGCGACCCGCGCTACCGCATGCTG
GAGCATCTGTCGCCTAAGTTCAAGATGTCGCCCGTGGAACGGGAGCCAAGGGCCGCCCTCATCGTGAACCGCTTCACTCG
AAATCTGACCATCATGTTCGCGACCAACGCAACTGCGGCAATTCTTGGCCTACGGCCCGACCAGCTCAAAAACAAAAGCT
TCTACCGCTGCATACAGGAGAGCTGTCTGTCTGAAGCTATCACATGCCTGGAAAGCGCCAAAGCCAATGACTCGATTGCG
TATCTCCGCTTCAGCTTTCAGGACCCGAGGGACGATGAGGAGCTGGAGGCCGAGGCCGAGAGTGGAGTTGTTCTTGTTGA
CCACGAGGACGAGCTGGAACAGCGCCTACCCACAACAGGCCGCAAGCAGTTTGATGTCGATATGTCTATGGACATTGACT
CGGACAACGGCAGCACGGACATATTTCGGATCAAGACGGAGGAAGAGGACAAACCGCTTTCGATGCCGACTGTCCCTCTT
ATTATGCAGCCTCCGATCGGGTTTAATAGGCTAACACCGCGGCGGGCCCAGCGACTTCCGTCAGTCGAGTTGGAGGCCGT
TGTTTCGTGCACCTCGGACGGACTGGTCGTCGTGCTGAGAAAGGCGCGGCCTCCAATACCACCTGCACATCCACCTCTTG
TTGCGTTCGACTATGGCGACGGGCTCTTCGCCGCACCATGGGCCCAGCACCCAATAAGGCCGCATTTTCCAGTAGAATCC
CTCTACACCTTCCGGCCCCCCCTGCTACCACAGTACATGCCGTTGAGAGAGAATGTCAAAGATGCTGGTGGACCGCCCTT
GGACGTGCTGATGGGCTCCATTCGGGATGTAGCTGTGATTGCCTGGAACATTGGCACCCACCCGGCCATTGCGGCATACG
GACGTGGCCTTCCAAGCAGCGATGCACGACAGAATCAGCAGGGAGACAGTGATGCCGGTGTCGGCAGTGCTAGCGGCACT
ATGCAGCCAAGAAGCATAAACAAGGGAAAAGGACCAGCCGTCCCTGATGCACTCTACGGCCACGCCTATGCACACGACGG
CCGACTCAACAGTTACAGCTGCCGAGCCGATCAATCATCAGCACTCCCTGACCGACGGGGATCGTGTGGCATTCCATCCA
GCTGGACAACACAGGTTGATAGTGCTTCTGTGGGCTTTGGGACCTCGCCGCCCAGCCCAGCCTCCTTCGAGCACATGCGT
CCTCAGCTTCGACCACACAGCACCCTTGAAACACATCCCACTGGCGGCATCACTTTGTACTACGGATCTCCGGGAGCACA
AAGTGAGGCTGATGTACTACAGCCTGCATACGGTGTTCACATTTCAGGTCCTCGCCCGGACCTTGGCAGCTCGACCGGAG
ACCACTACCACAGGTGGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62