GenePrediction:GLEAN_5185 Details

Name: GLEAN_5185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1317299..1316006 (- strand)
Length: 1294
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1317299..1317203 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_97:1317118..1316425 (- strand)
Length: 694
Type: CDS
Source: GLEAN
Position: GCSC_97:1316330..1316101 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_97:1316016..1316006 (- strand)
Length: 11
>GLEAN_5185 class=GenePrediction position=GCSC_97:1317299..1316006 (- strand)
ATGGCGTCGGTAAACCGGAAAGACTACGGGCCTACGCCGCAGGTGGAAGATGACGATCTGATCGACCCGGATGATGGCAA
GTTCCCTTTTTTCATCAGTCTTGAGGGGATGAAGGCCGGGTGACAACCAGGGTCGGCAGGGGATGAAAGCCACTTGCTAA
CAAGAGACGGTCAACCTGCAGCTGACCTGGACGACCTGGACGATCTCGATGACCCGATGACGGCGGCCAGCGCGTCCAAA
GCTCCTCTGCGAGGAAACATCGGCCAGTCCCCATCTAGCGGTGGCATCGGCAGTGGCAGTGGCAGCGGCAGCGGTAGTGG
CAGCGGCAGCGGTGGGGGTGCCGGTGGTGGACCGTCCAGCTTTGGGCGGTCGCTGAGCGAGAACTATCTGACGTCGCAGA
TCCCGGGTGAGGACCGGCGGGCGCCGACGAACACGATCGACGAGACGGTGTGGGCGACGCTGCGACGGGACCTGCTGGCG
GTGTGGGCCAAGATGCGCGAGGTGCTGTATCCACGGTACCTCTTTGGCGGCAGCATGTTTGACGACACACAGGAGAGCGG
CGTGGGTGGCGGCGGTCTGCGCGGGGCCTACGCGACGCTGCGCAGCGCCGGTCTCTCGGGCACGCGCGACGAGCTGGCCG
GGCTGGCCGGACGCGTCATGGACCCGGAGTCGCTGCTGCGGCAGAGCAACATGACGCCCGGCCTGCGCGACTGGGACCTC
TGGGGCCCACTCGTGTTCTGCCTGCTGCTCAGCATGCTGCTGAGCTTCAACGCGCGGTCGAACCAGCGCGACCTCGTCTT
CTCGGGCGTCTTTGCGATGGTGTGGATCGGCGAGGCCGTGGTGACGCTGCAGATCAAGTTGCTGGGCGGAAATATGTACG
TCCTTTCTTTCTTTTCCTTTCTTTCCTCTTCTTTCTTCCTTCTTTTCTTTCTTCCATGTCATCTCCTTCCCTCCGCTAAT
GCAACCCAGCTCCTTCGCCCAGAGCGTGTGCATCATCGGTTACACCCTCTTCCCGCTGGTGCTGGCAGCCCTGCTCTCGG
CCCTGCACCTGCCAACGGTGGCCCGCATACCCATCTACCTCGTGCTCATCGCCTGGGCCATGGCGGCTGGCGTCAGCATC
CTGGGCGGCAGTGGCGTGCTCAAGAACCGCGTCGGCATTGCCGTGTACCCGCTCCTCGTCTTCTACATCGGCCTGGGCTG
TCTGTGTTTTATTAGCTGAGCGAGCGAGCGAGCGAGCACAGGCCAGGGACAGCAATTTCCGAGCAGCTCCCGAGTCACAA
CAGCCAATTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62